Transcript: Mouse XM_006521285.1

PREDICTED: Mus musculus copine VIII (Cpne8), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cpne8 (66871)
Length:
3045
CDS:
5..1540

Additional Resources:

NCBI RefSeq record:
XM_006521285.1
NBCI Gene record:
Cpne8 (66871)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521285.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000454926 GAACTGAAGTGATCGATAATA pLKO_005 39 CDS 100% 15.000 21.000 N Cpne8 n/a
2 TRCN0000423510 ACGTGCTGCAGACGCAAATAT pLKO_005 1518 CDS 100% 15.000 12.000 N Cpne8 n/a
3 TRCN0000011965 GCTTCCCATGTCAATAATAAT pLKO.1 1228 CDS 100% 15.000 12.000 N Cpne8 n/a
4 TRCN0000011963 CCGTGGGAGTTTCAACTTATA pLKO.1 2139 3UTR 100% 13.200 10.560 N Cpne8 n/a
5 TRCN0000421517 CAGTCTCTGTGTCGATGTTTA pLKO_005 1914 3UTR 100% 13.200 9.240 N Cpne8 n/a
6 TRCN0000431035 GTGTCATGGAAGCTTACTATA pLKO_005 1029 CDS 100% 13.200 9.240 N Cpne8 n/a
7 TRCN0000011964 GCAGTCACAATTCAACGTCTA pLKO.1 619 CDS 100% 4.050 2.835 N Cpne8 n/a
8 TRCN0000011967 GCTCCCGTAATAAACCACGTA pLKO.1 1091 CDS 100% 2.640 1.848 N Cpne8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521285.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09610 pDONR223 100% 80.3% 89.1% None (many diffs) n/a
2 ccsbBroad304_09610 pLX_304 0% 80.3% 89.1% V5 (many diffs) n/a
3 TRCN0000470434 CTCCCATCACTATCATTTATGTTA pLX_317 27.4% 80.3% 89.1% V5 (many diffs) n/a
4 ccsbBroadEn_13223 pDONR223 100% 40.1% 45.5% None (many diffs) n/a
5 ccsbBroad304_13223 pLX_304 0% 40.1% 45.5% V5 (many diffs) n/a
6 TRCN0000473730 ACGAAGTGACAGATCGCCCCAGAT pLX_317 35.3% 40.1% 45.5% V5 (many diffs) n/a
Download CSV