Transcript: Human XR_245896.4

PREDICTED: Homo sapiens copine 8 (CPNE8), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CPNE8 (144402)
Length:
1700
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_245896.4
NBCI Gene record:
CPNE8 (144402)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_245896.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145295 GCAGTCACAATTCAACGTATA pLKO.1 831 3UTR 100% 10.800 15.120 N CPNE8 n/a
2 TRCN0000419379 TTTGATGCAATGGTCGAATTG pLKO_005 1620 3UTR 100% 10.800 15.120 N CPNE8 n/a
3 TRCN0000141687 CCAACTGAATGCCTATGGTAT pLKO.1 1062 3UTR 100% 4.950 6.930 N CPNE8 n/a
4 TRCN0000419528 GACTAAGGAGTCCATAGTTAA pLKO_005 1547 3UTR 100% 13.200 10.560 N CPNE8 n/a
5 TRCN0000435025 CCAACTTTGCTCCTGTAATTA pLKO_005 1295 3UTR 100% 15.000 10.500 N CPNE8 n/a
6 TRCN0000433592 GATCCAATTTGTGTCTTATAT pLKO_005 190 3UTR 100% 15.000 10.500 N CPNE8 n/a
7 TRCN0000424629 CATTAAGGGAGGGACGCAAAT pLKO_005 960 3UTR 100% 10.800 7.560 N CPNE8 n/a
8 TRCN0000141026 CAGGGAAGAAATGTGGTACAA pLKO.1 473 3UTR 100% 4.950 3.465 N CPNE8 n/a
9 TRCN0000142376 GCTTTGAATGGGAATCCTCAA pLKO.1 1195 3UTR 100% 4.050 2.835 N CPNE8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_245896.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09610 pDONR223 100% 79.7% None (many diffs) n/a
2 ccsbBroad304_09610 pLX_304 0% 79.7% V5 (many diffs) n/a
3 TRCN0000470434 CTCCCATCACTATCATTTATGTTA pLX_317 27.4% 79.7% V5 (many diffs) n/a
4 ccsbBroadEn_13223 pDONR223 100% 27.2% None 1_1050del;1329_1465del;1700_1701ins186 n/a
5 ccsbBroad304_13223 pLX_304 0% 27.2% V5 1_1050del;1329_1465del;1700_1701ins186 n/a
6 TRCN0000473730 ACGAAGTGACAGATCGCCCCAGAT pLX_317 35.3% 27.2% V5 1_1050del;1329_1465del;1700_1701ins186 n/a
Download CSV