Construct: ORF TRCN0000473838
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011941.1_s317c1
- Derived from:
- ccsbBroadEn_03543
- DNA Barcode:
- GCAATTAGCCGATATCTATGACTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RMDN3 (55177)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473838
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55177 | RMDN3 | regulator of microtubule dy... | NM_001304802.1 | 100% | 100% | |
| 2 | human | 55177 | RMDN3 | regulator of microtubule dy... | NM_001323894.1 | 100% | 100% | |
| 3 | human | 55177 | RMDN3 | regulator of microtubule dy... | NM_018145.3 | 100% | 100% | |
| 4 | human | 55177 | RMDN3 | regulator of microtubule dy... | NM_001323896.1 | 94.7% | 94.7% | 807_884del |
| 5 | human | 55177 | RMDN3 | regulator of microtubule dy... | NM_001323897.1 | 94.7% | 94.7% | 807_884del |
| 6 | human | 55177 | RMDN3 | regulator of microtubule dy... | NM_001323895.1 | 72.5% | 72.5% | 0_1ins387 |
| 7 | human | 55177 | RMDN3 | regulator of microtubule dy... | XM_011521755.2 | 56.1% | 56.1% | 0_1ins618 |
| 8 | mouse | 67809 | Rmdn3 | regulator of microtubule dy... | NM_001033136.3 | 83.9% | 84.5% | (many diffs) |
| 9 | mouse | 67809 | Rmdn3 | regulator of microtubule dy... | XR_866337.2 | 54.5% | (many diffs) | |
| 10 | mouse | 67809 | Rmdn3 | regulator of microtubule dy... | XR_374514.1 | 50% | (many diffs) | |
| 11 | mouse | 67809 | Rmdn3 | regulator of microtubule dy... | XR_001783170.1 | 40.1% | (many diffs) | |
| 12 | mouse | 67809 | Rmdn3 | regulator of microtubule dy... | XR_001783171.1 | 30.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1476
- ORF length:
- 1410
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tagactggga gccctgggtg gtgcccgtgc cgggctggga ctgttgctgg 121 gtaccgccgc cggccttgga ttcctgtgcc tcctttacag ccagcgatgg aaacggaccc 181 agcgtcatgg ccgcagccag agcctgccca actccctgga ctatacgcag acttcagatc 241 ccggacgcca cgtgatgctc ctgcgggctg tcccaggtgg ggctggagat gcctcagtgc 301 tgcccagcct tccacgggaa ggacaggaga aggtgctgga ccgcctggac tttgtgctga 361 ccagccttgt ggcgctgcgg cgggaggtgg aggagctgag aagcagcctg cgagggcttg 421 cgggggagat tgttggggag gtccgatgcc acatggaaga gaaccagaga gtggctcggc 481 ggcgaaggtt tccgtttgtc cgggagagga gtgactccac tggctccagc tctgtctact 541 tcacggcctc ctcgggagcc acgttcacag atgctgagag tgaagggggt tacacaacag 601 ccaatgcgga gtctgacaat gagcgggact ctgacaaaga aagtgaggac ggggaagatg 661 aagtgagctg tgagactgtg aagatgggga gaaaggattc tcttgacttg gaggaagagg 721 cagcttcagg tgcctccagt gccctggagg ctggaggttc ctcaggcttg gaggatgtgc 781 tgcccctcct gcagcaggcc gacgagctgc acaggggtga tgagcaaggc aagcgggagg 841 gcttccagct gctgctcaac aacaagctgg tgtatggaag ccggcaggac tttctctggc 901 gcctggcccg agcctacagt gacatgtgtg agctcactga ggaggtgagc gagaagaagt 961 catatgccct agatggaaaa gaagaagcag aggctgctct ggagaagggg gatgagagtg 1021 ctgactgtca cctgtggtat gcggtgcttt gtggTCAGCT GGCTGAGCAT GAGAGCATCC 1081 AGAGGCGCAT CCAGAGTGGC TTTAGCTTCA AGGAGCATGT GGACAAAGCC ATTGCTCTCC 1141 AGCCAGAAAA CCCCATGGCT CACTTTCTTC TTGGCAGGTG GTGCTATCAG GTCTCTCACC 1201 TGAGCTGGCT AGAAAAAAAA ACTGCTACAG CCTTGCTTGA AAGCCCTCTC AGTGCCACTG 1261 TGGAAGATGC CCTCCAGAGC TTCCTAAAGG CTGAAGAACT ACAGCCAGGA TTTTCCAAAG 1321 CAGGAAGGGT ATATATTTCC AAGTGCTACA GAGAACTAGG GAAAAACTCT GAAGCTAGAT 1381 GGTGGATGAA GTTGGCCCTG GAGCTGCCAG ATGTCACGAA GGAGGATTTG GCTATCCAGA 1441 AGGACCTGGA AGAACTGGAA GTCATTTTAC GAGACTACCC AACTTTCTTG TACAAAGTGG 1501 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1561 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1621 AGCAATTAGC CGATATCTAT GACTTACGCG TTAAGTCgac aatcaacctc tggattacaa 1681 aatttgtgaa agatt