Transcript: Mouse XR_001783170.1

PREDICTED: Mus musculus regulator of microtubule dynamics 3 (Rmdn3), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rmdn3 (67809)
Length:
2972
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001783170.1
NBCI Gene record:
Rmdn3 (67809)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001783170.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283454 GAACTGCCAGACGTCACTAAT pLKO_005 2196 3UTR 100% 13.200 18.480 N Rmdn3 n/a
2 TRCN0000346085 GAAGAAGTCCTATGCCCTAAA pLKO_005 1020 3UTR 100% 10.800 8.640 N Rmdn3 n/a
3 TRCN0000283456 TCTAATCTCCTACCTTAATTT pLKO_005 2448 3UTR 100% 15.000 10.500 N Rmdn3 n/a
4 TRCN0000346086 TGGAAGAACTAGAAGTAATTT pLKO_005 2242 3UTR 100% 15.000 10.500 N Rmdn3 n/a
5 TRCN0000346080 TGGATTCCTGTGCGTCCTTTA pLKO_005 201 3UTR 100% 10.800 7.560 N Rmdn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001783170.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03543 pDONR223 100% 40.1% None (many diffs) n/a
2 ccsbBroad304_03543 pLX_304 0% 40.1% V5 (many diffs) n/a
3 TRCN0000473838 GCAATTAGCCGATATCTATGACTT pLX_317 30.2% 40.1% V5 (many diffs) n/a
Download CSV