Transcript: Human NM_001304802.1

Homo sapiens regulator of microtubule dynamics 3 (RMDN3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
RMDN3 (55177)
Length:
2307
CDS:
232..1644

Additional Resources:

NCBI RefSeq record:
NM_001304802.1
NBCI Gene record:
RMDN3 (55177)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304802.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435309 ATGACTTGATGCCACTATTTA pLKO_005 1664 3UTR 100% 15.000 21.000 N RMDN3 n/a
2 TRCN0000412991 CAAAGCAGGAAGGGTATATAT pLKO_005 1482 CDS 100% 15.000 10.500 N RMDN3 n/a
3 TRCN0000136248 GTGAGCGAGAAGAAGTCATAT pLKO.1 1111 CDS 100% 13.200 9.240 N RMDN3 n/a
4 TRCN0000136194 GAAGAACTACAGCCAGGATTT pLKO.1 1459 CDS 100% 10.800 7.560 N RMDN3 n/a
5 TRCN0000135580 GACTATACGCAGACTTCAGAT pLKO.1 385 CDS 100% 4.950 3.465 N RMDN3 n/a
6 TRCN0000135881 GAGATCAGGAAACCACACAAA pLKO.1 1725 3UTR 100% 4.950 3.465 N RMDN3 n/a
7 TRCN0000134562 GAGAAAGGATTCTCTTGACTT pLKO.1 855 CDS 100% 0.495 0.347 N RMDN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304802.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03543 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03543 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473838 GCAATTAGCCGATATCTATGACTT pLX_317 30.2% 100% 100% V5 n/a
Download CSV