Construct: ORF TRCN0000473936
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003050.1_s317c1
- Derived from:
- ccsbBroadEn_13435
- DNA Barcode:
- GGATCTAGTCGAAAGCACCTCTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FBXL13 (222235)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473936
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 222235 | FBXL13 | F-box and leucine rich repe... | NM_001287150.2 | 99.9% | 99.7% | 222T>G;1991A>G |
| 2 | human | 222235 | FBXL13 | F-box and leucine rich repe... | NM_145032.3 | 96% | 95.9% | 222T>G;1634_1717del;2075A>G |
| 3 | human | 222235 | FBXL13 | F-box and leucine rich repe... | XM_005250209.2 | 96% | 95.9% | 222T>G;1634_1717del;2075A>G |
| 4 | human | 222235 | FBXL13 | F-box and leucine rich repe... | XM_011515930.2 | 96% | 95.9% | 222T>G;1634_1717del;2075A>G |
| 5 | human | 222235 | FBXL13 | F-box and leucine rich repe... | XM_017011853.1 | 96% | 95.9% | 222T>G;1634_1717del;2075A>G |
| 6 | human | 222235 | FBXL13 | F-box and leucine rich repe... | NM_001111038.2 | 95.1% | 93.6% | (many diffs) |
| 7 | human | 222235 | FBXL13 | F-box and leucine rich repe... | XM_017011852.1 | 90.5% | 90.3% | (many diffs) |
| 8 | human | 222235 | FBXL13 | F-box and leucine rich repe... | XM_011515928.3 | 88.6% | 88.4% | 1_270del;492T>G;2261A>G |
| 9 | human | 222235 | FBXL13 | F-box and leucine rich repe... | XM_017011850.2 | 85.9% | 85.7% | (many diffs) |
| 10 | human | 222235 | FBXL13 | F-box and leucine rich repe... | XM_005250205.4 | 85.6% | 85.4% | (many diffs) |
| 11 | human | 222235 | FBXL13 | F-box and leucine rich repe... | XM_005250208.4 | 84.5% | 83.1% | (many diffs) |
| 12 | human | 222235 | FBXL13 | F-box and leucine rich repe... | XM_005250207.4 | 81.6% | 81.4% | (many diffs) |
| 13 | human | 222235 | FBXL13 | F-box and leucine rich repe... | XM_011515929.3 | 80% | 77.8% | (many diffs) |
| 14 | human | 222235 | FBXL13 | F-box and leucine rich repe... | XM_017011851.2 | 80% | 78.3% | (many diffs) |
| 15 | human | 222235 | FBXL13 | F-box and leucine rich repe... | XM_006715898.3 | 75.1% | 73.8% | (many diffs) |
| 16 | human | 222235 | FBXL13 | F-box and leucine rich repe... | XM_024446687.1 | 73.5% | 70.9% | (many diffs) |
| 17 | human | 222235 | FBXL13 | F-box and leucine rich repe... | NR_105043.2 | 69.9% | (many diffs) | |
| 18 | human | 222235 | FBXL13 | F-box and leucine rich repe... | XM_011515932.3 | 68.6% | 68.2% | (many diffs) |
| 19 | human | 222235 | FBXL13 | F-box and leucine rich repe... | XR_927408.3 | 67.9% | (many diffs) | |
| 20 | human | 222235 | FBXL13 | F-box and leucine rich repe... | XR_927410.3 | 61% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2187
- ORF length:
- 2121
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac tccggaattg atgataaaag cctgtagctt ttatactgga catttagtaa 121 agactcattt ttgcacttgg agagacatag ctcgtacaaa tgaaaatgtc gtcctggctg 181 aaaaaatgaa cagagcagtg acatgctaca atttcagact tcaaaaatct gtatttcatc 241 actggcactc ttatatggaa gaccagaaag aaaaacttaa aaatatgcta ttgcggatac 301 aacagatcat ctattgtcac aagctaacca ttatcctaac aaaatggcgg aatacagcaa 361 gacataagag taaaaagaaa gaagatgagc tgatattaaa acatgaactt caattgaaaa 421 aatggaaaaa taggttaata ctcaaaagag ctgctgcaga agaatccaat tttcctgaac 481 gaagttcttc tgaagtcttt cttgtagatg agactctaaa atgtgacatt tcactgttac 541 ctgaaagagc aatattacag attttcttct acctcagttt aaaagatgtg ataatatgtg 601 gtcaagttaa tcatgcctgg atgttgatga cacaactaaa ctcactgtgg aatgctattg 661 atttttcctc agtgaaaaat gtgattccag ataaatatat agtgtctact ttgcaaaggt 721 ggcgtttaaa tgtgctgcgt ttgaattttc gtggttgtct tctccgaccc aaaactttca 781 gatctgtcag ccactgtagg aacttgcaag agttgaatgt ctctgactgc ccaacattca 841 cagatgaatc aatgagacac atttctgagg gctgcccggg ggtcctgtgt ctcaatctgt 901 ctaacacaac tatcaccaac aggacgatgc gactcctgcc gaggcacttc cacaacttac 961 agaatcttag tttggcttat tgcagacggt tcacagacaa aggcttacag tacctgaact 1021 tggggaatgg atgccacaag ctcatctatc tggacctctc tggctgcacc cagatttcag 1081 tccaaggctt caggtacatt gcaaacagct gcactggaat tatgcatctt accattaatg 1141 acatgccaac tctgacggac aactgtgtaa aagctttagt tgaaaaatgc tctcgtatta 1201 catcgctggt tttcactggt gcaccgcata tctccgattg tactttcaga gctctttctg 1261 cttgtaaact cagaaagatc cgatttgaag gaaataaaag ggttactgat gcatccttca 1321 aatttataga caagaattat ccaaatctca gtcacattta tatggctgac tgcaagggaa 1381 taacagacag cagcctcaga tccctttcac ctttgaagca actgactgtg ttgaatttgg 1441 caaattgtgt aagaattggt gatatgggac taaagcaatt tcttgatggt cctgcaagca 1501 tgaggataag agagctaaat ttaagcaact gtgtgcggct aagtgatgcc tctgttatga 1561 aactatctga gcgctgccct aatttaaact acttgagttt acgaaattgt gaacatttga 1621 ctgcccaagg aattggatat attgtaaaca tcttttcctt ggtatcaata gatctctctg 1681 gaacagacat ctctaatgag gcattctgca aaagctcact gatcttggaa catttGGATG 1741 TCTCTTATTG CTCCCAGCTG TCAGATATGA TTATCAAAGC ACTGGCCATT TACTGCATTA 1801 ACCTCACATC TCTCAGCATT GCTGGCTGTC CAAAGATTAC TGACTCAGCA ATGGAGATGT 1861 TATCGGCAAA ATGCCATTAC CTGCACATTT TGGATATCTC TGGTTGTGTC TTGCTTACTG 1921 ACCAAATCCT TGAGGACCTT CAGATAGGCT GCAAACAACT CCGGATCCTT AAGATGCAAT 1981 ACTGCACAAA TATTTCCAAG AAGGCAGCTC AAAGAATGTC ATCTAAAGTT CAGCAGCAGG 2041 AATACAACAC TAATGGCCCT CCACGTTGGT TTGGCTATGA TAGGGAAGGA AACCCTGTTA 2101 CAGAGCTTGA CAACATAACA TCATCTAAAG GAGCCTTAGA ATTAACAGTG AAAAAGTCAA 2161 CATACAGCAG TGAAGACCAA GCAGCGTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 2221 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 2281 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAGGATCTAG 2341 TCGAAAGCAC CTCTTCACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 2401 aagatt