Transcript: Human NR_105043.2

Homo sapiens F-box and leucine rich repeat protein 13 (FBXL13), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
FBXL13 (222235)
Length:
2908
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_105043.2
NBCI Gene record:
FBXL13 (222235)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_105043.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118582 CGGATACAACAGATCATCTAT pLKO.1 525 3UTR 100% 5.625 7.875 N FBXL13 n/a
2 TRCN0000130115 CGGATACAACAGATCATCTAT pLKO.1 525 3UTR 100% 5.625 7.875 N FBXL13 n/a
3 TRCN0000128066 CTCGTATTACATCGCTGGTTT pLKO.1 1423 3UTR 100% 4.950 6.930 N FBXL13 n/a
4 TRCN0000118585 GCGGATACAACAGATCATCTA pLKO.1 524 3UTR 100% 4.950 6.930 N FBXL13 n/a
5 TRCN0000118584 CGGTTCACAGACAAAGGCTTA pLKO.1 1218 3UTR 100% 4.050 5.670 N FBXL13 n/a
6 TRCN0000128074 GCGTTTAAATGTGCTGCGTTT pLKO.1 953 3UTR 100% 4.050 5.670 N FBXL13 n/a
7 TRCN0000128047 GCCCAACATTCACAGATGAAT pLKO.1 1060 3UTR 100% 0.563 0.788 N FBXL13 n/a
8 TRCN0000118586 CAGCAGGAATACAACACTAAT pLKO.1 2272 3UTR 100% 13.200 9.240 N FBXL13 n/a
9 TRCN0000118583 GCAGCAGGAATACAACACTAA pLKO.1 2271 3UTR 100% 4.950 3.465 N FBXL13 n/a
10 TRCN0000128033 GCAGCAGGAATACAACACTAA pLKO.1 2271 3UTR 100% 4.950 3.465 N FBXL13 n/a
11 TRCN0000128046 GCAAGAGTTGAATGTCTCTGA pLKO.1 1037 3UTR 100% 2.640 1.848 N FBXL13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_105043.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13435 pDONR223 100% 69.9% None (many diffs) n/a
2 ccsbBroad304_13435 pLX_304 0% 69.9% V5 (many diffs) n/a
3 TRCN0000473936 GGATCTAGTCGAAAGCACCTCTTC pLX_317 21.5% 69.9% V5 (many diffs) n/a
Download CSV