Transcript: Human XM_006715898.3

PREDICTED: Homo sapiens F-box and leucine rich repeat protein 13 (FBXL13), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBXL13 (222235)
Length:
1999
CDS:
132..1886

Additional Resources:

NCBI RefSeq record:
XM_006715898.3
NBCI Gene record:
FBXL13 (222235)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715898.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128066 CTCGTATTACATCGCTGGTTT pLKO.1 805 CDS 100% 4.950 6.930 N FBXL13 n/a
2 TRCN0000118584 CGGTTCACAGACAAAGGCTTA pLKO.1 600 CDS 100% 4.050 5.670 N FBXL13 n/a
3 TRCN0000128074 GCGTTTAAATGTGCTGCGTTT pLKO.1 335 CDS 100% 4.050 5.670 N FBXL13 n/a
4 TRCN0000128047 GCCCAACATTCACAGATGAAT pLKO.1 442 CDS 100% 0.563 0.788 N FBXL13 n/a
5 TRCN0000118586 CAGCAGGAATACAACACTAAT pLKO.1 1731 CDS 100% 13.200 9.240 N FBXL13 n/a
6 TRCN0000128013 GCTCACTGATCTTGGAACATT pLKO.1 1411 CDS 100% 5.625 3.938 N FBXL13 n/a
7 TRCN0000118583 GCAGCAGGAATACAACACTAA pLKO.1 1730 CDS 100% 4.950 3.465 N FBXL13 n/a
8 TRCN0000128033 GCAGCAGGAATACAACACTAA pLKO.1 1730 CDS 100% 4.950 3.465 N FBXL13 n/a
9 TRCN0000128046 GCAAGAGTTGAATGTCTCTGA pLKO.1 419 CDS 100% 2.640 1.848 N FBXL13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715898.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13435 pDONR223 100% 75.1% 73.8% None (many diffs) n/a
2 ccsbBroad304_13435 pLX_304 0% 75.1% 73.8% V5 (many diffs) n/a
3 TRCN0000473936 GGATCTAGTCGAAAGCACCTCTTC pLX_317 21.5% 75.1% 73.8% V5 (many diffs) n/a
Download CSV