Construct: ORF TRCN0000473940
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009464.1_s317c1
- Derived from:
- ccsbBroadEn_00747
- DNA Barcode:
- TCCCAAGGAGTGGAAGACATATGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HLF (3131)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473940
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3131 | HLF | HLF transcription factor, P... | NM_002126.5 | 100% | 100% | |
| 2 | human | 3131 | HLF | HLF transcription factor, P... | XM_005257269.3 | 99.6% | 99.6% | 671_673delAGC |
| 3 | human | 3131 | HLF | HLF transcription factor, P... | NM_001330375.2 | 71.1% | 71.1% | 0_1ins255 |
| 4 | human | 3131 | HLF | HLF transcription factor, P... | XM_011524705.1 | 70.9% | 70.9% | 0_1ins255;416_418delAGC |
| 5 | mouse | 217082 | Hlf | hepatic leukemia factor | NM_172563.3 | 91.6% | 97.6% | (many diffs) |
| 6 | mouse | 217082 | Hlf | hepatic leukemia factor | XM_006533004.1 | 91.3% | 97.2% | (many diffs) |
| 7 | mouse | 217082 | Hlf | hepatic leukemia factor | XM_006533007.2 | 64.9% | 70.5% | (many diffs) |
| 8 | mouse | 217082 | Hlf | hepatic leukemia factor | XM_006533005.3 | 64.7% | 70.2% | (many diffs) |
| 9 | mouse | 217082 | Hlf | hepatic leukemia factor | XM_006533006.1 | 64.7% | 70.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 951
- ORF length:
- 885
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gaaaatgtcc cgaccgctcc ccctgaatcc cacctttatc ccgcctccct 121 acggcgtgct caggtccctg ctggagaacc cgctgaagct cccccttcac cacgaagacg 181 catttagtaa agataaagac aaggaaaaga agctggatga tgagagtaac agcccgacgg 241 tcccccagtc ggcattcctg gggcctacct tatgggacaa aacccttccc tatgacggag 301 atactttcca gttggaatac atggacctgg aggagttttt gtcagaaaat ggcattcccc 361 ccagcccatc tcagcatgac cacagccctc accctcctgg gctgcagcca gcttcctcgg 421 ctgccccctc ggtcatggac ctcagcagcc gggcctctgc accccttcac cctggcatcc 481 catctccgaa ctgtatgcag agccccatca gaccaggtca gctgttgcca gcaaaccgca 541 atacaccaag tcccattgat cctgacacca tccaggtccc agtgggttat gagCCAGACC 601 CAGCAGATCT TGCCCTTTCC AGCATCCCTG GCCAGGAAAT GTTTGACCCT CGCAAACGCA 661 AGTTCTCTGA GGAAGAACTG AAGCCACAGC CCATGATCAA GAAAGCTCGC AAAGTCTTCA 721 TCCCTGATGA CCTGAAGGAT GACAAGTACT GGGCAAGGCG CAGAAAGAAC AACATGGCAG 781 CCAAGCGCTC CCGCGACGCC CGGAGGCTGA AAGAGAACCA GATCGCCATC CGGGCCTCGT 841 TCCTGGAGAA GGAGAACTCG GCCCTCCGCC AGGAGGTGGC TGACTTGAGG AAGGAGCTGG 901 GCAAATGCAA GAACATACTT GCCAAGTATG AGGCCAGGCA CGGGCCCCTG TACCCAACTT 961 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1021 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1081 CTTGTGGAAA GGACGATCCC AAGGAGTGGA AGACATATGG ACGCGTTAAG TCgacaatca 1141 acctctggat tacaaaattt gtgaaagatt