Transcript: Human NM_001330375.2

Homo sapiens HLF transcription factor, PAR bZIP family member (HLF), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
HLF (3131)
Length:
5175
CDS:
235..867

Additional Resources:

NCBI RefSeq record:
NM_001330375.2
NBCI Gene record:
HLF (3131)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330375.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014788 CGGTGCTATGTGTTTGGTTTA pLKO.1 2826 3UTR 100% 10.800 15.120 N HLF n/a
2 TRCN0000014790 CCCTTCCCTATGACGGAGATA pLKO.1 197 5UTR 100% 4.950 3.960 N HLF n/a
3 TRCN0000014789 GCTGGGCAAATGCAAGAACAT pLKO.1 810 CDS 100% 4.950 3.465 N HLF n/a
4 TRCN0000014792 GAAATGTTTGACCCTCGCAAA pLKO.1 550 CDS 100% 4.050 2.835 N HLF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330375.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00747 pDONR223 100% 71.1% 71.1% None 0_1ins255 n/a
2 ccsbBroad304_00747 pLX_304 0% 71.1% 71.1% V5 0_1ins255 n/a
3 TRCN0000473940 TCCCAAGGAGTGGAAGACATATGG pLX_317 40.6% 71.1% 71.1% V5 0_1ins255 n/a
Download CSV