Transcript: Human XM_005257269.3

PREDICTED: Homo sapiens HLF transcription factor, PAR bZIP family member (HLF), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HLF (3131)
Length:
5602
CDS:
526..1416

Additional Resources:

NCBI RefSeq record:
XM_005257269.3
NBCI Gene record:
HLF (3131)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257269.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014788 CGGTGCTATGTGTTTGGTTTA pLKO.1 3375 3UTR 100% 10.800 15.120 N HLF n/a
2 TRCN0000014790 CCCTTCCCTATGACGGAGATA pLKO.1 743 CDS 100% 4.950 3.960 N HLF n/a
3 TRCN0000014791 GAAGACGCATTTAGTAAAGAT pLKO.1 634 CDS 100% 5.625 3.938 N HLF n/a
4 TRCN0000014789 GCTGGGCAAATGCAAGAACAT pLKO.1 1359 CDS 100% 4.950 3.465 N HLF n/a
5 TRCN0000014792 GAAATGTTTGACCCTCGCAAA pLKO.1 1096 CDS 100% 4.050 2.835 N HLF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257269.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00747 pDONR223 100% 99.6% 99.6% None 671_673delAGC n/a
2 ccsbBroad304_00747 pLX_304 0% 99.6% 99.6% V5 671_673delAGC n/a
3 TRCN0000473940 TCCCAAGGAGTGGAAGACATATGG pLX_317 40.6% 99.6% 99.6% V5 671_673delAGC n/a
Download CSV