Construct: ORF TRCN0000473951
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017411.1_s317c1
- Derived from:
- ccsbBroadEn_02545
- DNA Barcode:
- ACTTCTAACCGCTTTGGAAAATCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CFHR3 (10878)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473951
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 10878 | CFHR3 | complement factor H related 3 | NM_021023.5 | 100% | 100% | |
2 | human | 10878 | CFHR3 | complement factor H related 3 | NM_001166624.1 | 81.5% | 81.5% | 429_430ins183 |
3 | human | 10877 | CFHR4 | complement factor H related 4 | NM_006684.5 | 66.7% | 63.8% | (many diffs) |
4 | human | 10878 | CFHR3 | complement factor H related 3 | XR_426757.2 | 65.7% | (many diffs) | |
5 | human | 10877 | CFHR4 | complement factor H related 4 | XM_017000110.1 | 59.7% | 52.6% | (many diffs) |
6 | human | 10877 | CFHR4 | complement factor H related 4 | XM_017000114.1 | 57% | 52.4% | (many diffs) |
7 | human | 10878 | CFHR3 | complement factor H related 3 | XR_241062.3 | 55.5% | 1_71del;685_884del;972_973ins289 | |
8 | human | 10877 | CFHR4 | complement factor H related 4 | NM_001201551.2 | 53.7% | 47.3% | (many diffs) |
9 | human | 10877 | CFHR4 | complement factor H related 4 | NM_001201550.3 | 53.6% | 47.2% | (many diffs) |
10 | human | 10877 | CFHR4 | complement factor H related 4 | XM_006711129.3 | 52.5% | 46.1% | (many diffs) |
11 | human | 10878 | CFHR3 | complement factor H related 3 | XR_001736938.1 | 46.7% | (many diffs) | |
12 | human | 10878 | CFHR3 | complement factor H related 3 | XR_002958987.1 | 46.3% | (many diffs) | |
13 | human | 10878 | CFHR3 | complement factor H related 3 | XR_001736937.1 | 38.3% | (many diffs) | |
14 | human | 3075 | CFH | complement factor H | NM_001014975.2 | 21.7% | 18% | (many diffs) |
15 | human | 3075 | CFH | complement factor H | XM_017001108.2 | 21.5% | 18% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1056
- ORF length:
- 990
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt gttactaatc aatgtcattc tgaccttgtg ggtttcctgt gctaatggac 121 aagtgaaacc ttgtgatttt ccagacatta aacatggagg tctatttcat gagaatatgc 181 gtagaccata ctttccagta gctgtaggaa aatattactc ctattactgt gatgaacatt 241 ttgagactcc ttcaggaagt tactgggatt acattcattg cacacaaaat gggtggtcac 301 cagcagtacc atgtctcaga aaatgttatt ttccttattt ggaaaatgga tataatcaaa 361 attatggaag aaagtttgta cagggtaact ctacagaagt tgcctgccat cctggctacg 421 gtcttccaaa agcgcagacc acagttacat gtacggagaa aggctggtct cctactccca 481 gatgcatccg tgtcagaaca tgctcaaaat cagatataga aattgaaaat ggattcattt 541 ccgaatcttc ctctatttat attttaaata aagaaataca atataaatgt aaaccaggat 601 atgcaacagc agatggaaat tcttcaggat caattacatg tttGCAAAAT GGATGGTCAG 661 CACAACCAAT TTGCATTAAT TCTTCAGAAA AGTGTGGGCC TCCTCCACCT ATTAGCAATG 721 GTGATACCAC CTCCTTTCTA CTAAAAGTGT ATGTGCCACA GTCAAGAGTC GAGTACCAAT 781 GCCAGCCCTA CTATGAACTT CAGGGTTCTA ATTATGTAAC ATGTAGTAAT GGAGAGTGGT 841 CGGAACCACC AAGATGCATA CATCCATGTA TAATAACTGA AGAAAACATG AATAAAAATA 901 ACATAAAGTT AAAAGGAAGA AGTGACAGAA AATATTATGC AAAAACAGGG GATACCATTG 961 AATTTATGTG TAAATTGGGA TATAATGCAA ATACATCAAT TCTATCATTT CAAGCAGTGT 1021 GTCGGGAAGG GATAGTGGAA TACCCCAGAT GCGAATACCC AACTTTCTTG TACAAAGTGG 1081 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1141 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1201 AACTTCTAAC CGCTTTGGAA AATCGACGCG TTAAGTCgac aatcaacctc tggattacaa 1261 aatttgtgaa agatt