Transcript: Human XR_001736938.1

PREDICTED: Homo sapiens complement factor H related 3 (CFHR3), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CFHR3 (10878)
Length:
1791
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001736938.1
NBCI Gene record:
CFHR3 (10878)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001736938.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161075 GTACAGGGTAACTCTACAGAA pLKO.1 384 3UTR 100% 4.950 3.465 N CFHR3 n/a
2 TRCN0000160270 CCTATTACTGTGATGAACATT pLKO.1 226 3UTR 100% 5.625 2.813 Y CFHR3 n/a
3 TRCN0000151005 GCTACGATGGATATGAAATCA pLKO.1 1609 3UTR 100% 5.625 2.813 Y CFHR4 n/a
4 TRCN0000152010 CACCTATTAGCAATGGTGATA pLKO.1 1726 3UTR 100% 4.950 2.475 Y CFHR4 n/a
5 TRCN0000154099 CTACGAATGCTACGATGGATA pLKO.1 1601 3UTR 100% 4.950 2.475 Y CFHR4 n/a
6 TRCN0000158714 GATTACATTCATTGCACACAA pLKO.1 273 3UTR 100% 4.950 2.475 Y CFHR3 n/a
7 TRCN0000152424 CCACCTATTAGCAATGGTGAT pLKO.1 1725 3UTR 100% 4.050 2.025 Y CFHR4 n/a
8 TRCN0000160732 CCACCTATTAGCAATGGTGAT pLKO.1 1725 3UTR 100% 4.050 2.025 Y CFHR3 n/a
9 TRCN0000162111 CGTAGACCATACTTTCCAGTA pLKO.1 186 3UTR 100% 4.050 2.025 Y CFHR3 n/a
10 TRCN0000164248 CAATGGTGATACCACCTCCTT pLKO.1 1736 3UTR 100% 2.640 1.320 Y CFHR3 n/a
11 TRCN0000159305 GCACAACCAATTTGCATTAAT pLKO.1 666 3UTR 100% 15.000 7.500 Y CFHR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001736938.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02545 pDONR223 100% 46.7% None (many diffs) n/a
2 ccsbBroad304_02545 pLX_304 0% 46.7% V5 (many diffs) n/a
3 TRCN0000473951 ACTTCTAACCGCTTTGGAAAATCG pLX_317 41.8% 46.7% V5 (many diffs) n/a
4 ccsbBroadEn_11563 pDONR223 100% 38.8% None 1_71del;768_1791del n/a
5 ccsbBroad304_11563 pLX_304 0% 38.8% V5 1_71del;768_1791del n/a
6 TRCN0000480539 CTATGAAGGAACCGGTGGGAACCC pLX_317 51.6% 38.8% V5 1_71del;768_1791del n/a
7 ccsbBroadEn_11562 pDONR223 100% 32.4% None (many diffs) n/a
8 ccsbBroad304_11562 pLX_304 0% 32.4% V5 (many diffs) n/a
9 TRCN0000469795 TCAAAACACGGAAATGTGCTACGT pLX_317 40.4% 32.4% V5 (many diffs) n/a
10 ccsbBroadEn_06361 pDONR223 100% 17.3% None (many diffs) n/a
11 ccsbBroad304_06361 pLX_304 0% 17.3% V5 (many diffs) n/a
12 TRCN0000492032 TTGACTGCTTACAACATTAGGGGG pLX_317 29% 17.3% V5 (many diffs) n/a
Download CSV