Transcript: Human XM_017000114.1

PREDICTED: Homo sapiens complement factor H related 4 (CFHR4), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CFHR4 (10877)
Length:
1770
CDS:
102..1265

Additional Resources:

NCBI RefSeq record:
XM_017000114.1
NBCI Gene record:
CFHR4 (10877)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000114.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157357 CAAGAGTAATGGCATGCGGTT pLKO.1 746 CDS 100% 2.160 3.024 N CFHR4 n/a
2 TRCN0000153846 CAATGCCAGTCCTACTATGAA pLKO.1 984 CDS 100% 5.625 3.375 N CFHR4 n/a
3 TRCN0000159530 CATTTCTGAATCTTCCTCTAT pLKO.1 566 CDS 100% 4.950 2.970 N CFHR3 n/a
4 TRCN0000151005 GCTACGATGGATATGAAATCA pLKO.1 796 CDS 100% 5.625 2.813 Y CFHR4 n/a
5 TRCN0000152010 CACCTATTAGCAATGGTGATA pLKO.1 913 CDS 100% 4.950 2.475 Y CFHR4 n/a
6 TRCN0000154099 CTACGAATGCTACGATGGATA pLKO.1 788 CDS 100% 4.950 2.475 Y CFHR4 n/a
7 TRCN0000152424 CCACCTATTAGCAATGGTGAT pLKO.1 912 CDS 100% 4.050 2.025 Y CFHR4 n/a
8 TRCN0000160732 CCACCTATTAGCAATGGTGAT pLKO.1 912 CDS 100% 4.050 2.025 Y CFHR3 n/a
9 TRCN0000162111 CGTAGACCATACTTTCCAGTA pLKO.1 387 CDS 100% 4.050 2.025 Y CFHR3 n/a
10 TRCN0000164248 CAATGGTGATACCACCTCCTT pLKO.1 923 CDS 100% 2.640 1.320 Y CFHR3 n/a
11 TRCN0000153682 CCTACTATGAACTTCAGGGTT pLKO.1 253 CDS 100% 2.640 1.320 Y CFHR4 n/a
12 TRCN0000159305 GCACAACCAATTTGCATTAAT pLKO.1 690 CDS 100% 15.000 7.500 Y CFHR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000114.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07697 pDONR223 100% 83% 79% None (many diffs) n/a
2 ccsbBroad304_07697 pLX_304 0% 83% 79% V5 (many diffs) n/a
3 TRCN0000475890 AATCATTTAAAAAATACAGGTTTG pLX_317 25% 83% 79% V5 (many diffs) n/a
4 ccsbBroadEn_02545 pDONR223 100% 57% 52.4% None (many diffs) n/a
5 ccsbBroad304_02545 pLX_304 0% 57% 52.4% V5 (many diffs) n/a
6 TRCN0000473951 ACTTCTAACCGCTTTGGAAAATCG pLX_317 41.8% 57% 52.4% V5 (many diffs) n/a
Download CSV