Construct: ORF TRCN0000474088
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009991.1_s317c1
- Derived from:
- ccsbBroadEn_00429
- DNA Barcode:
- GCCACAGGGGGTCCTCCCAGCAAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AKR1C2 (1646)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474088
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1646 | AKR1C2 | aldo-keto reductase family ... | NM_001354.5 | 100% | 100% | |
| 2 | human | 1646 | AKR1C2 | aldo-keto reductase family ... | NM_205845.2 | 100% | 100% | |
| 3 | human | 1645 | AKR1C1 | aldo-keto reductase family ... | NM_001353.6 | 98% | 97.8% | (many diffs) |
| 4 | human | 1646 | AKR1C2 | aldo-keto reductase family ... | NM_001321027.1 | 91.9% | 91.9% | 367_368ins78 |
| 5 | human | 8644 | AKR1C3 | aldo-keto reductase family ... | NM_001253908.1 | 91.4% | 86.6% | (many diffs) |
| 6 | human | 8644 | AKR1C3 | aldo-keto reductase family ... | NM_003739.6 | 91.2% | 86.9% | (many diffs) |
| 7 | human | 1645 | AKR1C1 | aldo-keto reductase family ... | XM_017015791.2 | 89.9% | 89.7% | (many diffs) |
| 8 | human | 1109 | AKR1C4 | aldo-keto reductase family ... | NM_001818.4 | 88.3% | 81.7% | (many diffs) |
| 9 | human | 1646 | AKR1C2 | aldo-keto reductase family ... | NM_001135241.2 | 41.7% | 38.1% | (many diffs) |
| 10 | human | 8644 | AKR1C3 | aldo-keto reductase family ... | NM_001253909.2 | 37.4% | 34.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1035
- ORF length:
- 969
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ttcgaaatac cagtgtgtga agctgaatga tggtcacttc atgcctgtcc 121 tgggatttgg cacctatgcg cctgcagagg ttcctaaaag taaagctcta gaggccgtca 181 aattggcaat agaagccggg ttccaccata ttgattctgc acatgtttac aataatgagg 241 agcaggttgg actggccatc cgaagcaaga ttgcagatgg cagtgtgaag agagaagaca 301 tattctacac ttcaaagctt tggagcaatt cccatcgacc agagttggtc cgaccagcct 361 tggaaaggtc actgaaaaat cttcaattgg actatgttga cctctatctt attcattttc 421 cagtgtctgt aaagccaggt gaggaagtga tcccaaaaga tgaaaatgga aaaatactat 481 ttgacacagt ggatctctgt gccacatGGG AGGCCATGGA GAAGTGTAAA GATGCAGGAT 541 TGGCCAAGTC CATCGGGGTG TCCAACTTCA ACCACAGGCT GCTGGAGATG ATCCTCAACA 601 AGCCAGGGCT CAAGTACAAG CCTGTCTGCA ACCAGGTGGA ATGTCATCCT TACTTCAACC 661 AGAGAAAACT GCTGGATTTC TGCAAGTCAA AAGACATTGT TCTGGTTGCC TATAGTGCTC 721 TGGGATCCCA TCGAGAAGAA CCATGGGTGG ACCCGAACTC CCCGGTGCTC TTGGAGGACC 781 CAGTCCTTTG TGCCTTGGCA AAAAAGCACA AGCGAACCCC AGCCCTGATT GCCCTGCGCT 841 ACCAGCTGCA GCGTGGGGTT GTGGTCCTGG CCAAGAGCTA CAATGAGCAG CGCATCAGAC 901 AGAACGTGCA GGTGTTTGAA TTCCAGTTGA CTTCAGAGGA GATGAAAGCC ATAGATGGCC 961 TAAACAGAAA TGTGCGATAT TTGACCCTTG ATATTTTTGC TGGCCCCCCT AATTATCCAT 1021 TTTCTGATGA ATATTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1081 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGCCCGTAA CTTGAAAGTA 1141 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA GCCACAGGGG GTCCTCCCAG 1201 CAACACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt