Transcript: Human NM_003739.6

Homo sapiens aldo-keto reductase family 1 member C3 (AKR1C3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
AKR1C3 (8644)
Length:
1186
CDS:
32..1003

Additional Resources:

NCBI RefSeq record:
NM_003739.6
NBCI Gene record:
AKR1C3 (8644)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003739.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026540 CCGTATTTCAACCGGAGTAAA pLKO.1 614 CDS 100% 13.200 18.480 N AKR1C3 n/a
2 TRCN0000278399 CCGTATTTCAACCGGAGTAAA pLKO_005 614 CDS 100% 13.200 18.480 N AKR1C3 n/a
3 TRCN0000026561 CCAGAGGTTCCGAGAAGTAAA pLKO.1 110 CDS 100% 13.200 10.560 N AKR1C3 n/a
4 TRCN0000278400 CCAGAGGTTCCGAGAAGTAAA pLKO_005 110 CDS 100% 13.200 10.560 N AKR1C3 n/a
5 TRCN0000026564 CCGGAGTAAATTGCTAGATTT pLKO.1 625 CDS 100% 13.200 9.240 N AKR1C3 n/a
6 TRCN0000278350 CCGGAGTAAATTGCTAGATTT pLKO_005 625 CDS 100% 13.200 9.240 N AKR1C3 n/a
7 TRCN0000026525 CTCACTGAAGAAAGCTCAATT pLKO.1 334 CDS 100% 13.200 9.240 N AKR1C3 n/a
8 TRCN0000278348 CTCACTGAAGAAAGCTCAATT pLKO_005 334 CDS 100% 13.200 9.240 N AKR1C3 n/a
9 TRCN0000025694 CCTAGACAGAAATCTCCACTA pLKO.1 925 CDS 100% 4.050 2.835 N AKR1C3 n/a
10 TRCN0000278349 CCTAGACAGAAATCTCCACTA pLKO_005 925 CDS 100% 4.050 2.835 N AKR1C3 n/a
11 TRCN0000338769 ATGTTGACCTCTATCTTATTC pLKO_005 360 CDS 100% 13.200 6.600 Y AKR1C2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003739.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01979 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01979 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470055 CTAACGCAGCTGGGGGCTCATTCC pLX_317 31.7% 100% 100% V5 n/a
4 ccsbBroadEn_07279 pDONR223 100% 99.6% 100% None 90G>A;312G>A;546C>T n/a
5 ccsbBroad304_07279 pLX_304 0% 99.6% 100% V5 90G>A;312G>A;546C>T n/a
6 TRCN0000472656 TGTTTCCACATAATGTTAGATTCA pLX_317 50.9% 99.6% 100% V5 90G>A;312G>A;546C>T n/a
7 ccsbBroadEn_06088 pDONR223 100% 91.6% 87.9% None (many diffs) n/a
8 ccsbBroad304_06088 pLX_304 0% 91.6% 87.9% V5 (many diffs) n/a
9 TRCN0000479983 AGCTCTACATACTCGCGCACTCGG pLX_317 30.1% 90.4% 62.8% V5 (not translated due to prior stop codon) (many diffs) n/a
10 TRCN0000466588 CAATCAATAACCTCAGTACCACGA pLX_317 30.1% 90.4% 62.8% V5 (not translated due to prior stop codon) (many diffs) n/a
11 ccsbBroadEn_00429 pDONR223 100% 91.2% 86.9% None (many diffs) n/a
12 ccsbBroad304_00429 pLX_304 0% 91.2% 86.9% V5 (many diffs) n/a
13 TRCN0000474088 GCCACAGGGGGTCCTCCCAGCAAC pLX_317 54.3% 91.2% 86.9% V5 (many diffs) n/a
14 ccsbBroadEn_15395 pDONR223 0% 91.1% 86.9% None (many diffs) n/a
15 ccsbBroad304_15395 pLX_304 0% 91.1% 86.9% V5 (many diffs) n/a
16 TRCN0000469197 CGTTCACGTCATAGCGTTCCCGAA pLX_317 45.9% 91.1% 86.9% V5 (many diffs) n/a
17 ccsbBroadEn_05989 pDONR223 100% 88.4% 84.2% None (many diffs) n/a
18 ccsbBroad304_05989 pLX_304 0% 88.4% 84.2% V5 (many diffs) n/a
19 TRCN0000470334 TGTTCAACCACATTCTAATTAGTC pLX_317 39.5% 88.4% 84.2% V5 (many diffs) n/a
Download CSV