Construct: ORF TRCN0000474230
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010381.1_s317c1
- Derived from:
- ccsbBroadEn_03627
- DNA Barcode:
- TAAGCTGAAGAGCTTTCGTTAATA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RUFY2 (55680)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474230
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | NM_001042417.1 | 100% | 100% | |
| 2 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | NM_001278225.1 | 78.7% | 78.4% | 0_1ins174;2_3delTGinsAA;123_224del |
| 3 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | XM_005269957.5 | 68.3% | 65.5% | (many diffs) |
| 4 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | NM_001330103.2 | 64.5% | 61.7% | (many diffs) |
| 5 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | XM_011539942.2 | 64.5% | 61.7% | (many diffs) |
| 6 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | XM_005269953.4 | 64.3% | 61.6% | (many diffs) |
| 7 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | XM_005269955.4 | 61.8% | 59% | (many diffs) |
| 8 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | NM_017987.4 | 60.9% | 58.1% | (many diffs) |
| 9 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | XR_001747132.2 | 56.8% | (many diffs) | |
| 10 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | NR_103476.2 | 54.5% | (many diffs) | |
| 11 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | XM_005269956.4 | 52.2% | 49.4% | (many diffs) |
| 12 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | NR_103475.2 | 48.2% | (many diffs) | |
| 13 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | XR_001747130.2 | 27.7% | (many diffs) | |
| 14 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | XR_001747131.2 | 27.3% | (many diffs) | |
| 15 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | XR_246097.2 | 25.3% | (many diffs) | |
| 16 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | XR_001747134.1 | 21.6% | (many diffs) | |
| 17 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | XR_001747129.1 | 20.9% | (many diffs) | |
| 18 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | XR_001747133.1 | 20.9% | 1_113del;1323_5780del | |
| 19 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | XR_001747127.2 | 20.6% | 1_96del;393_494del;1408_5865del | |
| 20 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | XR_001747125.1 | 20.1% | 1_235delinsA;531_632del;1546_6003del | |
| 21 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | XR_001747126.1 | 19.8% | 1_433delinsA;1642_6099del | |
| 22 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | XR_001747128.1 | 19.3% | 1_489del;786_887del;1801_6258del | |
| 23 | human | 55680 | RUFY2 | RUN and FYVE domain contain... | XR_001747135.2 | 17.7% | (many diffs) | |
| 24 | mouse | 70432 | Rufy2 | RUN and FYVE domain-contain... | XM_017314087.1 | 79.8% | 88.5% | (many diffs) |
| 25 | mouse | 70432 | Rufy2 | RUN and FYVE domain-contain... | XM_006514089.3 | 73.8% | 81.9% | (many diffs) |
| 26 | mouse | 70432 | Rufy2 | RUN and FYVE domain-contain... | XM_006514088.1 | 66% | 69.6% | (many diffs) |
| 27 | mouse | 70432 | Rufy2 | RUN and FYVE domain-contain... | NM_027425.3 | 56.7% | 59.7% | (many diffs) |
| 28 | mouse | 70432 | Rufy2 | RUN and FYVE domain-contain... | XM_006514087.1 | 56.5% | 59.5% | (many diffs) |
| 29 | mouse | 70432 | Rufy2 | RUN and FYVE domain-contain... | XM_011243562.2 | 54.3% | 57% | (many diffs) |
| 30 | mouse | 70432 | Rufy2 | RUN and FYVE domain-contain... | XR_001779596.1 | 40.4% | (many diffs) | |
| 31 | mouse | 70432 | Rufy2 | RUN and FYVE domain-contain... | XR_001779594.1 | 24.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1275
- ORF length:
- 1209
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tacaaaagac cccacagctg tagagagagc aaacttgtta aacatggcta 121 aactgagtat caaaggactc attgaatctg ctctgagctt tggccgcact ttggattctg 181 actatccccc cttgcagcaa ttctttgttg ttatggaaca ttgcctgaaa cacggtctta 241 aagtaagaaa atcatttttg agttacaaca aaaccatctg gggccctttg gaactggtgg 301 agaagctgta ccccgaagca gaggaaatag gagctagtgt ccgggatcta cctggtctga 361 atgagtttta tgagtatcac gcactaatga tggaagaaga aggagcagta attgttgggc 421 tgctggttgg cctgaatgtg atcgatgcta atctgtgtgt gaagggagag gatttagact 481 cacaagttgg agtgattgat ttttctatgt atttaaagaa tgaagaagat attggaaata 541 aagaaaggaa tgttcaaatt gctgccatat tagaccaaaa gaattatgtt gaagaattaa 601 atagacaact gaacagcaca gtcagcagcc tccattcaag agttgattca ttagaaaagt 661 caaatactaa gctgattgaa gagttagcaa tagcaaagaa taacatcatt aaactccagg 721 aagaaaatca tcaattacga agtgaaaata aattgatttt aatgaaaaca cagcagcacc 781 TAGAGGTTAC CAAAGTAGAT GTGGAAACTG AGCTTCAAAC ATATAAGCAT TCTCGTCAGG 841 GGCTAGATGA AATGTACAAT GAAGCCAGAA GGCAGCTTCG AGATGAATCT CAGTTACGAC 901 AGGATGTAGA GAATGAGCTA GCAGTACAAG TTAGTATGAA GCATGAGATT GAACTTGCCA 961 TGAAGTTGCT GGAGAAAGAT ATCCATGAGA AACAAGATAC TCTGATAGGC CTTCGACAAC 1021 AACTAGAGGA AGTTAAAGCA ATTAACATAG AGATGTATCA AAAGTTGCAG GGTTCTGAAG 1081 ATGGCTTGAA AGAAAAAAAT GAAATAATTG CCCGACTAGA AGAAAAAACC AATAAAATTA 1141 CTGCAGCCAT GAGGCAGCTG GAACAAAGTG ACAACGATTT GTTAACTCAA ACTAGGACAA 1201 TTGCAATGTC ATTGGTGAAA TGTGCCAGCA GTGACACGCA GGACCAGTAC AAGCTGGTTA 1261 AAGATATATC TTTCTGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1321 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1381 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TAAGCTGAAG AGCTTTCGTT 1441 AATAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt