Transcript: Mouse XM_017314087.1

PREDICTED: Mus musculus RUN and FYVE domain-containing 2 (Rufy2), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rufy2 (70432)
Length:
2834
CDS:
101..1411

Additional Resources:

NCBI RefSeq record:
XM_017314087.1
NBCI Gene record:
Rufy2 (70432)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314087.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329459 AGTTAGCAATAGCGAAGAATA pLKO_005 816 CDS 100% 13.200 18.480 N Rufy2 n/a
2 TRCN0000177580 CGATTACTTGCGTTGCTTAAT pLKO.1 457 CDS 100% 13.200 18.480 N Rufy2 n/a
3 TRCN0000329457 CGATTACTTGCGTTGCTTAAT pLKO_005 457 CDS 100% 13.200 18.480 N Rufy2 n/a
4 TRCN0000178560 CGAGAAACAAGACACTCTCAT pLKO.1 1120 CDS 100% 4.950 6.930 N Rufy2 n/a
5 TRCN0000419435 TGGCTAAACTGAGTATCAAAG pLKO_005 150 CDS 100% 10.800 7.560 N RUFY2 n/a
6 TRCN0000177556 CATGGCTAAACTGAGTATCAA pLKO.1 148 CDS 100% 5.625 3.938 N Rufy2 n/a
7 TRCN0000329456 CATGGCTAAACTGAGTATCAA pLKO_005 148 CDS 100% 5.625 3.938 N Rufy2 n/a
8 TRCN0000176971 GCAATCAACATTGAGATGTAT pLKO.1 1172 CDS 100% 5.625 3.938 N Rufy2 n/a
9 TRCN0000329527 GCAATCAACATTGAGATGTAT pLKO_005 1172 CDS 100% 5.625 3.938 N Rufy2 n/a
10 TRCN0000177178 GAGAAACAAGACACTCTCATA pLKO.1 1121 CDS 100% 4.950 3.465 N Rufy2 n/a
11 TRCN0000198322 GCTATCAGTACAAGTTGGCAT pLKO.1 1051 CDS 100% 2.640 1.848 N Rufy2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314087.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03627 pDONR223 100% 79.8% 88.5% None (many diffs) n/a
2 ccsbBroad304_03627 pLX_304 0% 79.8% 88.5% V5 (many diffs) n/a
3 TRCN0000474230 TAAGCTGAAGAGCTTTCGTTAATA pLX_317 41% 79.8% 88.5% V5 (many diffs) n/a
Download CSV