Construct: ORF TRCN0000474232
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001966.1_s317c1
- Derived from:
- ccsbBroadEn_15010
- DNA Barcode:
- AGTACCACTGACGGGGACGCTCCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CRTC1 (23373)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474232
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23373 | CRTC1 | CREB regulated transcriptio... | NM_015321.3 | 74.6% | 74.4% | (many diffs) |
| 2 | human | 23373 | CRTC1 | CREB regulated transcriptio... | NM_001098482.2 | 72.8% | 72.6% | (many diffs) |
| 3 | human | 23373 | CRTC1 | CREB regulated transcriptio... | XM_005259834.1 | 70% | 69.8% | (many diffs) |
| 4 | human | 23373 | CRTC1 | CREB regulated transcriptio... | XM_005259833.3 | 68.3% | 68.1% | (many diffs) |
| 5 | human | 23373 | CRTC1 | CREB regulated transcriptio... | XM_011527842.3 | 67.4% | 67.2% | (many diffs) |
| 6 | human | 23373 | CRTC1 | CREB regulated transcriptio... | XM_017026536.1 | 62.3% | 62.1% | (many diffs) |
| 7 | human | 23373 | CRTC1 | CREB regulated transcriptio... | XM_005259835.3 | 59.6% | 59.5% | (many diffs) |
| 8 | human | 23373 | CRTC1 | CREB regulated transcriptio... | XM_005259836.3 | 54.3% | 54.1% | (many diffs) |
| 9 | human | 23373 | CRTC1 | CREB regulated transcriptio... | XM_024451434.1 | 52.9% | 52.8% | (many diffs) |
| 10 | human | 23373 | CRTC1 | CREB regulated transcriptio... | XM_006722710.3 | 51.6% | 51.5% | (many diffs) |
| 11 | human | 23373 | CRTC1 | CREB regulated transcriptio... | XM_017026537.1 | 49.8% | 48.4% | (many diffs) |
| 12 | mouse | 382056 | Crtc1 | CREB regulated transcriptio... | XM_011242313.2 | 78.8% | 82.1% | (many diffs) |
| 13 | mouse | 382056 | Crtc1 | CREB regulated transcriptio... | XM_006509704.2 | 78.5% | 82.2% | (many diffs) |
| 14 | mouse | 382056 | Crtc1 | CREB regulated transcriptio... | XM_011242312.2 | 77.1% | 77.2% | (many diffs) |
| 15 | mouse | 382056 | Crtc1 | CREB regulated transcriptio... | XM_006509700.3 | 66.5% | 69.3% | (many diffs) |
| 16 | mouse | 382056 | Crtc1 | CREB regulated transcriptio... | XM_011242310.2 | 63.7% | 66.4% | (many diffs) |
| 17 | mouse | 382056 | Crtc1 | CREB regulated transcriptio... | NM_001004062.2 | 62.5% | 65.1% | (many diffs) |
| 18 | mouse | 382056 | Crtc1 | CREB regulated transcriptio... | XM_011242311.2 | 59.9% | 62.5% | (many diffs) |
| 19 | mouse | 382056 | Crtc1 | CREB regulated transcriptio... | XM_006509699.3 | 58.2% | 60.9% | (many diffs) |
| 20 | mouse | 382056 | Crtc1 | CREB regulated transcriptio... | XM_011242309.2 | 55.9% | 58.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1491
- ORF length:
- 1425
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac gcccacgcag ccaccatcct ttagcagtgg gtcccaggac gtgcaccaga 121 aaagagtctt actgttaaca gtcccaggaa tggaagagac cacatcagag gcagacaaaa 181 acctttccaa gcaagcatgg gacaccaaga agacggggtc caggcccaag tcctgtgagg 241 tccccggaat caacatcttc ccgtctgccg accaggaaaa cactacagcc ctgatccccg 301 ccacccacaa cacagggggg tccctgcccg acctgaccaa catccacttc ccctccccgc 361 tcccgacccc gctggacccc gaggagccca ccttccctgc actgagcagc tccagcagca 421 ccggcaacct cgcggccaac ctgacgcacc tgggcatcgg tggcgccggc cagggaatga 481 gcacacctgg ctcctctcca cagcaccgcc cagctggcgt cagccccctg tccctgagca 541 cagaggcaag gcgtcagcag gcatcgcccg ccctgtcccc gctgtcaccc atcactcagg 601 ctgtagccat ggacgccctg tctctggagc agcagctgcc ctacgccttc ttcacccagg 661 cgggctccca gcagccaccg ccgcagcccc agcccccgcc gcctcctcca cccgcgtcca 721 cgcagccacc acccccgcca cccccacagg cgcccgtccg cctgccccct ggtggccccc 781 tgttgcccag cgccagcctg actcgtgggc cacagccgcc cccgcttgca gtcacggtac 841 cgtcctctct cccccagtcc cccccagaga accctggcca gccatcgatg gggatcgaca 901 tcgcctcggc gccggctctg cagcagtacc gcactagcgc cggctccccg gccaaccagt 961 ctcccacctc gccagtcTCC AATCAAGGCT TCTCCCCAGG GAGCTCCCCG CAACACACTT 1021 CCACCCTGGG CAGCGTGTTT GGGGACGCGT ACTATGAGCA GCAGATGGCG GCCAGGCAGG 1081 CCAATGCTCT GTCCCACCAG CTGGAGCAGT TCAACATGAT GGAGAACGCC ATCAGCTCCA 1141 GCAGCCTGTA CAGCCCGGGC TCCACACTCA ACTACTCGCA GGCGGCCATG ATGGGCCTCA 1201 CGGGCAGCCA CGGGAGCCTG CCGGACTCGC AGCAACTGGG ATACGCCAGC CACAGTGGCA 1261 TCCCCAACAT CATCCTCACA GTGACAGGAG AGTCCCCCCC CAGCCTCTCT AAAGAACTGA 1321 CCAGCTCTCT GGCCGGGGTC GGCGACGTCA GCTTCGACTC CGACAGCCAG TTTCCCCTGG 1381 ACGAACTCAA GATCGACCCC CTGACCCTCG ACGGACTGCA CATGCTCAAC GACCCCGACA 1441 TGGTTCTGGC CGACCCAGCC ACCGAGGACA CCTTCCGGAT GGACCGCCTG TGCCCAACTT 1501 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1561 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1621 CTTGTGGAAA GGACGAAGTA CCACTGACGG GGACGCTCCT ACGCGTTAAG TCgacaatca 1681 acctctggat tacaaaattt gtgaaagatt