Transcript: Mouse XM_011242309.2

PREDICTED: Mus musculus CREB regulated transcription coactivator 1 (Crtc1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Crtc1 (382056)
Length:
2437
CDS:
74..1960

Additional Resources:

NCBI RefSeq record:
XM_011242309.2
NBCI Gene record:
Crtc1 (382056)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242309.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242281 CGGGCTCCACACTCAACTATT pLKO_005 1623 CDS 100% 13.200 9.240 N Crtc1 n/a
2 TRCN0000242284 GGGCTTGTGGACAGAGTATAT pLKO_005 368 CDS 100% 13.200 9.240 N Crtc1 n/a
3 TRCN0000242282 CGCACCAGAAGAGAGTCTTAC pLKO_005 597 CDS 100% 10.800 7.560 N Crtc1 n/a
4 TRCN0000242283 TTGATTCAGACCATCAGTTTC pLKO_005 1821 CDS 100% 10.800 7.560 N Crtc1 n/a
5 TRCN0000175746 GCAGTTCAACATGATGGAGAA pLKO.1 1573 CDS 100% 4.050 2.835 N Crtc1 n/a
6 TRCN0000173774 CCAACGTGAACCAGATTGGAA pLKO.1 270 CDS 100% 3.000 2.100 N Crtc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242309.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07872 pDONR223 100% 77.5% 81.9% None (many diffs) n/a
2 ccsbBroad304_07872 pLX_304 0% 77.5% 81.9% V5 (many diffs) n/a
3 TRCN0000467955 ACCTGTGTCCAGGGATGACCTATC pLX_317 7.7% 77.5% 81.9% V5 (many diffs) n/a
4 ccsbBroadEn_15010 pDONR223 56.1% 55.9% 58.4% None (many diffs) n/a
5 ccsbBroad304_15010 pLX_304 0% 55.9% 58.4% V5 (many diffs) n/a
6 TRCN0000474232 AGTACCACTGACGGGGACGCTCCT pLX_317 36.2% 55.9% 58.4% V5 (many diffs) n/a
Download CSV