Construct: ORF TRCN0000474261
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000871.1_s317c1
- Derived from:
- ccsbBroadEn_07311
- DNA Barcode:
- TACCTCCATAAACCGAAGAATGAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HDAC3 (8841)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474261
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 8841 | HDAC3 | histone deacetylase 3 | NM_003883.4 | 99.9% | 100% | 165A>G |
2 | human | 8841 | HDAC3 | histone deacetylase 3 | NM_001355039.2 | 96% | 92.1% | (many diffs) |
3 | human | 8841 | HDAC3 | histone deacetylase 3 | NR_149167.2 | 72.4% | (many diffs) | |
4 | human | 8841 | HDAC3 | histone deacetylase 3 | NR_149168.1 | 65.1% | (many diffs) | |
5 | human | 8841 | HDAC3 | histone deacetylase 3 | NM_001355040.1 | 64.2% | 63% | 0_1ins403;17_18ins56 |
6 | human | 8841 | HDAC3 | histone deacetylase 3 | NR_149164.1 | 61.8% | (many diffs) | |
7 | human | 8841 | HDAC3 | histone deacetylase 3 | NR_149169.1 | 61% | (many diffs) | |
8 | human | 8841 | HDAC3 | histone deacetylase 3 | NR_149165.1 | 57.9% | (many diffs) | |
9 | human | 8841 | HDAC3 | histone deacetylase 3 | NM_001355041.1 | 56.3% | 56.3% | 0_1ins561 |
10 | human | 8841 | HDAC3 | histone deacetylase 3 | NR_149166.1 | 55.6% | (many diffs) | |
11 | mouse | 15183 | Hdac3 | histone deacetylase 3 | NM_010411.2 | 92.4% | 99.7% | (many diffs) |
12 | mouse | 15183 | Hdac3 | histone deacetylase 3 | XR_385976.3 | 58.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1350
- ORF length:
- 1284
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc caagaccgtg gcctatttct acgaccccga cgtgggcaac ttccactacg 121 gagctggaca ccctatgaag ccccatcgcc tggcattgac ccatagcctg gtcctgcatt 181 acggtctcta taagaagatg atcgtcttca agccatacca ggcctcccag catgacatgt 241 gccgcttcca ctccgaggac tacattgact tcctgcagag agtcagcccc accaatatgc 301 aaggcttcac caagagtctt aatgccttca acgtaggcga tgactgccca gtgtttcccg 361 ggctctttga gttctgctcg cgttacacag gcgcatctct gcaaggagca acccagctga 421 acaacaagat ctgtgatatt gccattaact gggctggtgg tctgcaccat gccaagaagt 481 ttgaggcctc tggcttctgc tatgtcaacg acattgtgat tggcatcctg gagctgctca 541 agtaccaccc tcgggtgctc tacattgaca ttgacatcca ccatggtgac ggggttcaag 601 aagctttcta cctcactgac cgggtcatga cggtgtcctt ccacaaatac ggaaattact 661 tcttccctgg cacaggtgac atgtatgaag tcggggcaga gagtggccgc tactactgtc 721 tgaacgtgcc cctgcgggat ggcattgatg accagagtta caagcacctt ttccagccgg 781 ttatcaaCCA GGTAGTGGAC TTCTACCAAC CCACGTGCAT TGTGCTCCAG TGTGGAGCTG 841 ACTCTCTGGG CTGTGATCGA TTGGGCTGCT TTAACCTCAG CATCCGAGGG CATGGGGAAT 901 GCGTTGAATA TGTCAAGAGC TTCAATATCC CTCTACTCGT GCTGGGTGGT GGTGGTTATA 961 CTGTCCGAAA TGTTGCCCGC TGCTGGACAT ATGAGACATC GCTGCTGGTA GAAGAGGCCA 1021 TTAGTGAGGA GCTTCCCTAT AGTGAATACT TCGAGTACTT TGCCCCAGAC TTCACACTTC 1081 ATCCAGATGT CAGCACCCGC ATCGAGAATC AGAACTCACG CCAGTATCTG GACCAGATCC 1141 GCCAGACAAT CTTTGAAAAC CTGAAGATGC TGAACCATGC ACCTAGTGTC CAGATTCATG 1201 ACGTGCCTGC AGACCTCCTG ACCTATGACA GGACTGATGA GGCTGATGCA GAGGAGAGGG 1261 GTCCTGAGGA GAACTATAGC AGGCCAGAGG CACCCAATGA GTTCTATGAT GGAGACCATG 1321 ACAATGACAA GGAAAGCGAT GTGGAGATTT ACCCAACTTT CTTGTACAAA GTGGTTGATA 1381 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1441 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGATACCT 1501 CCATAAACCG AAGAATGACA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1561 tgaaagatt