Transcript: Human NM_003883.4

Homo sapiens histone deacetylase 3 (HDAC3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
HDAC3 (8841)
Length:
1933
CDS:
60..1346

Additional Resources:

NCBI RefSeq record:
NM_003883.4
NBCI Gene record:
HDAC3 (8841)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003883.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195333 CCTGCATTACGGTCTCTATAA pLKO.1 167 CDS 100% 13.200 18.480 N HDAC3 n/a
2 TRCN0000004827 CGGTCTCTATAAGAAGATGAT pLKO.1 176 CDS 100% 4.950 6.930 N HDAC3 n/a
3 TRCN0000199964 CTTTGAGTTCTGCTCGCGTTA pLKO.1 359 CDS 100% 4.050 5.670 N HDAC3 n/a
4 TRCN0000204890 CGCATCGAGAATCAGAACTCA pLKO.1 1092 CDS 100% 3.000 4.200 N HDAC3 n/a
5 TRCN0000197171 GACTTCACACTTCATCCAGAT pLKO.1 1062 CDS 100% 4.050 3.240 N HDAC3 n/a
6 TRCN0000004825 CCTTCCACAAATACGGAAATT pLKO.1 631 CDS 100% 13.200 9.240 N HDAC3 n/a
7 TRCN0000196267 GATAGCTATCTGGGACATTAT pLKO.1 1568 3UTR 100% 13.200 9.240 N HDAC3 n/a
8 TRCN0000196829 GATCTGTGATATTGCCATTAA pLKO.1 422 CDS 100% 13.200 9.240 N HDAC3 n/a
9 TRCN0000004826 GCACCCAATGAGTTCTATGAT pLKO.1 1284 CDS 100% 5.625 3.938 N HDAC3 n/a
10 TRCN0000004828 GCACCTAGTGTCCAGATTCAT pLKO.1 1173 CDS 100% 5.625 3.938 N HDAC3 n/a
11 TRCN0000194993 CAAGAGTCTTAATGCCTTCAA pLKO.1 305 CDS 100% 4.950 3.465 N HDAC3 n/a
12 TRCN0000199182 CTCTGGCTTCTGCTATGTCAA pLKO.1 482 CDS 100% 4.950 3.465 N HDAC3 n/a
13 TRCN0000196925 GCCTGACAATGGTACCTATTA pLKO.1 1528 3UTR 100% 0.000 0.000 N HDAC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003883.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07311 pDONR223 100% 99.9% 100% None 165A>G n/a
2 ccsbBroad304_07311 pLX_304 0% 99.9% 100% V5 165A>G n/a
3 TRCN0000474261 TACCTCCATAAACCGAAGAATGAC pLX_317 43.9% 99.9% 100% V5 165A>G n/a
4 TRCN0000491655 TAAACGACGTTATACGACACTCGA pLX_317 13.7% 99.9% 100% V5 (not translated due to prior stop codon) 165A>G n/a
Download CSV