Transcript: Mouse XR_385976.3

PREDICTED: Mus musculus histone deacetylase 3 (Hdac3), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hdac3 (15183)
Length:
2024
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_385976.3
NBCI Gene record:
Hdac3 (15183)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_385976.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039392 GAGGCCATTAGTGAGGAACTT pLKO.1 1050 3UTR 100% 4.950 6.930 N Hdac3 n/a
2 TRCN0000039393 GAGTTCTATGATGGCGACCAT pLKO.1 1335 3UTR 100% 2.640 3.696 N Hdac3 n/a
3 TRCN0000318153 GAGTTCTATGATGGCGACCAT pLKO_005 1335 3UTR 100% 2.640 3.696 N Hdac3 n/a
4 TRCN0000004825 CCTTCCACAAATACGGAAATT pLKO.1 647 3UTR 100% 13.200 10.560 N HDAC3 n/a
5 TRCN0000039391 GTGTTGAATATGTCAAGAGTT pLKO.1 937 3UTR 100% 4.950 3.960 N Hdac3 n/a
6 TRCN0000318152 GTGTTGAATATGTCAAGAGTT pLKO_005 937 3UTR 100% 4.950 3.960 N Hdac3 n/a
7 TRCN0000204890 CGCATCGAGAATCAGAACTCA pLKO.1 1134 3UTR 100% 3.000 2.400 N HDAC3 n/a
8 TRCN0000039390 CCTGCATTATGGTCTCTATAA pLKO.1 183 3UTR 100% 13.200 9.240 N Hdac3 n/a
9 TRCN0000318151 CCTGCATTATGGTCTCTATAA pLKO_005 183 3UTR 100% 13.200 9.240 N Hdac3 n/a
10 TRCN0000039389 CGTGGCTCTCTGAAACCTTAA pLKO.1 1800 3UTR 100% 10.800 7.560 N Hdac3 n/a
11 TRCN0000318154 CGTGGCTCTCTGAAACCTTAA pLKO_005 1800 3UTR 100% 10.800 7.560 N Hdac3 n/a
12 TRCN0000004826 GCACCCAATGAGTTCTATGAT pLKO.1 1326 3UTR 100% 5.625 3.938 N HDAC3 n/a
13 TRCN0000199182 CTCTGGCTTCTGCTATGTCAA pLKO.1 498 3UTR 100% 4.950 3.465 N HDAC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_385976.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07311 pDONR223 100% 58.6% None (many diffs) n/a
2 ccsbBroad304_07311 pLX_304 0% 58.6% V5 (many diffs) n/a
3 TRCN0000474261 TACCTCCATAAACCGAAGAATGAC pLX_317 43.9% 58.6% V5 (many diffs) n/a
4 TRCN0000491655 TAAACGACGTTATACGACACTCGA pLX_317 13.7% 58.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV