Construct: ORF TRCN0000474265
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011197.1_s317c1
- Derived from:
- ccsbBroadEn_12719
- DNA Barcode:
- ATACCAGTTGTTGACACCGACACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TRIM11 (81559)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474265
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 81559 | TRIM11 | tripartite motif containing 11 | XM_011544285.3 | 51.6% | 51.6% | 1_567del |
| 2 | human | 81559 | TRIM11 | tripartite motif containing 11 | XM_017002412.2 | 43.2% | 43.2% | 1_795del |
| 3 | human | 81559 | TRIM11 | tripartite motif containing 11 | NM_145214.3 | 43.1% | 43.1% | 1_798del |
| 4 | mouse | 94091 | Trim11 | tripartite motif-containing 11 | XM_011249335.2 | 70.5% | 74.3% | (many diffs) |
| 5 | mouse | 94091 | Trim11 | tripartite motif-containing 11 | XM_011249334.2 | 59.4% | 62.7% | (many diffs) |
| 6 | mouse | 94091 | Trim11 | tripartite motif-containing 11 | NM_053168.2 | 36.6% | 38.5% | (many diffs) |
| 7 | mouse | 94091 | Trim11 | tripartite motif-containing 11 | NM_001290988.1 | 35.3% | 37.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 672
- ORF length:
- 606
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gctgaggacc gtgtgcaggg tcccgggact ggtagagaca ctgcggaggt 121 ttcgagggga cgtgaccttg gacccggaca ccgccaaccc tgagctgatc ctgtctgaag 181 acaggcggag cgtgcagcgg ggggacctac ggcaggccct gccggacagc ccagagcgct 241 ttgaccccgg cccctgcgtg ctgggccagg agcgcttcac ctcaggccgc cactactggg 301 aggtggaggt tggggaccgc accagctggg ccctgggggt gtgcagggag aacgtgaaca 361 ggaaggagaa gggcgagctg tccgcgggca acggcttctg gatcctggtc ttcctgggga 421 gctattacaa ttcctcggaa cgggccttgg ctccactccg ggacccaccc aggcgcgtgg 481 ggatctttct ggactacgag gctggacatc tctctttcta cagtgccacc GATGGGTCAC 541 TGCTATTCAT CTTTCCCGAG ATCCCCTTCT CGGGGACGCT GCGGCCCCTC TTCTCACCCC 601 TGTCCAGCAG CCCGACCCCG ATGACTATCT GCCGGCCGAA AGGTGGGTCC GGGGACACCC 661 TGGCTCCCCA GTGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 721 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 781 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAATA CCAGTTGTTG ACACCGACAC 841 CACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t