Transcript: Mouse XM_011249335.2

PREDICTED: Mus musculus tripartite motif-containing 11 (Trim11), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trim11 (94091)
Length:
1835
CDS:
383..1111

Additional Resources:

NCBI RefSeq record:
XM_011249335.2
NBCI Gene record:
Trim11 (94091)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304675 ACATTTGTATTCGGCACATAA pLKO_005 1611 3UTR 100% 13.200 18.480 N Trim11 n/a
2 TRCN0000375977 GATGGGTCGCTGCTGTTTATC pLKO_005 968 CDS 100% 13.200 18.480 N Trim11 n/a
3 TRCN0000304618 CCAACCCTGAGCTGGTCTTAT pLKO_005 591 CDS 100% 13.200 9.240 N Trim11 n/a
4 TRCN0000311104 CTGCAGGCTGATAGGTGTATC pLKO_005 1066 CDS 100% 10.800 7.560 N Trim11 n/a
5 TRCN0000039517 CCCTCTTCTCACCTCTGTCAA pLKO.1 1023 CDS 100% 4.950 3.465 N Trim11 n/a
6 TRCN0000302287 CCCTCTTCTCACCTCTGTCAA pLKO_005 1023 CDS 100% 4.950 3.465 N Trim11 n/a
7 TRCN0000039514 CGTGTGTAAAGAAACTGCCAA pLKO.1 775 CDS 100% 2.640 1.848 N Trim11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12719 pDONR223 100% 70.5% 74.3% None (many diffs) n/a
2 ccsbBroad304_12719 pLX_304 0% 70.5% 74.3% V5 (many diffs) n/a
3 TRCN0000474265 ATACCAGTTGTTGACACCGACACC pLX_317 24.2% 70.5% 74.3% V5 (many diffs) n/a
Download CSV