Construct: ORF TRCN0000474268
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008545.1_s317c1
- Derived from:
- ccsbBroadEn_05342
- DNA Barcode:
- GGGGGATACACAACCCTTATTTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RAB40AL (282808)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474268
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 282808 | RAB40AL | RAB40A like | NM_001031834.1 | 100% | 100% | |
2 | human | 142684 | RAB40A | RAB40A, member RAS oncogene... | NM_080879.3 | 97.7% | 97.8% | (many diffs) |
3 | human | 10966 | RAB40B | RAB40B, member RAS oncogene... | NM_006822.3 | 90.4% | 88.8% | (many diffs) |
4 | human | 10966 | RAB40B | RAB40B, member RAS oncogene... | XM_011523528.2 | 80.7% | 76.9% | (many diffs) |
5 | human | 10966 | RAB40B | RAB40B, member RAS oncogene... | XM_006722271.3 | 77.6% | 76.2% | (many diffs) |
6 | human | 10966 | RAB40B | RAB40B, member RAS oncogene... | XM_005256334.4 | 70.5% | 68.2% | (many diffs) |
7 | human | 10966 | RAB40B | RAB40B, member RAS oncogene... | XM_017024042.1 | 70.5% | 68.2% | (many diffs) |
8 | human | 10966 | RAB40B | RAB40B, member RAS oncogene... | XM_017024043.1 | 70.5% | 68.2% | (many diffs) |
9 | human | 10966 | RAB40B | RAB40B, member RAS oncogene... | XM_024450550.1 | 70.5% | 68.2% | (many diffs) |
10 | human | 10966 | RAB40B | RAB40B, member RAS oncogene... | XM_024450551.1 | 70.5% | 68.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 903
- ORF length:
- 834
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gagcgccccg ggcagccccg accaggccta cgacttcctg ctcaagttcc 121 tgctggtggg cgacagggac gtaggcaaga gtgagatcct ggagagcctg caggacggca 181 cggccgagtc cccgtacagt cacctggggg gaatcgacta caagacgacc accatcctgc 241 tggacggcca gcgggtgaag ctgaagctct gggatacgtc ggggcaggga agattttgta 301 ccatattccg ctcctactct cgtggtgcac aaggagtgat cctggtctac gacattgcaa 361 accgctggtc tttcgagggt atggatcgat ggattaagaa gattgaggaa catgcccctg 421 gtgtccctaa aatcctggtg gggaatcgcc tacatctggc attcaagagg caggtgccca 481 gggagcaggc ccaggcctac gccgagcgcc tgggcgtgac cttctttgag gtcagccctc 541 tgtgcaattt caacatcata gagtctttca cggagctggc caggatagtg ctgctgcggc 601 acaggttgaa ctggctcggg aggccgagca aggtactgag cttgcaagac ctctgctgcc 661 gcaccatcgt gtcctgcaca cctgtgcatc tggtggacaa gctcccgctc cccattgcct 721 taagaagcca cctcaagtcc ttctccatgg ctaagggcct gaatGCCAGG ATGATGCGAG 781 GCCTCTCCTA CTCCCTCACC ACCAGCTCCA CTCACAAAAG GAGCAGCCTC TGCAAAGTGA 841 AGATCGTCTG CCCACCCCAG AGCCCACCCA AAAACTGCAC CAGAAACAGC TGCAAAATTT 901 CTTTGCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 961 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1021 GGCTTTATAT ATCTTGTGGA AAGGACGAGG GGGATACACA ACCCTTATTT TCACGCGTTA 1081 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt