Transcript: Human NM_001031834.1

Homo sapiens RAB40A like (RAB40AL), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
RAB40AL (282808)
Length:
1029
CDS:
48..884

Additional Resources:

NCBI RefSeq record:
NM_001031834.1
NBCI Gene record:
RAB40AL (282808)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001031834.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048365 CAGCCTCTGCAAAGTGAAGAT pLKO.1 803 CDS 100% 4.950 2.970 N RAB40AL n/a
2 TRCN0000048363 CTGTGCAATTTCAACATCATA pLKO.1 519 CDS 100% 5.625 2.813 Y RAB40AL n/a
3 TRCN0000047532 CCCTCTGTGCAATTTCAACAT pLKO.1 515 CDS 100% 4.950 2.475 Y RAB40B n/a
4 TRCN0000153551 CCCTCTGTGCAATTTCAACAT pLKO.1 515 CDS 100% 4.950 2.475 Y RAB40A n/a
5 TRCN0000048367 CCTGGTCTACGACATTGCAAA pLKO.1 320 CDS 100% 4.950 2.475 Y RAB40AL n/a
6 TRCN0000154807 GAGGGTATGGATCGATGGATT pLKO.1 354 CDS 100% 4.950 2.475 Y RAB40A n/a
7 TRCN0000184202 GAATCGCCTACATCTGGCATT pLKO.1 422 CDS 100% 4.050 2.025 Y RAB40A n/a
8 TRCN0000048366 CGACTACAAGACGACCACCAT pLKO.1 194 CDS 100% 2.640 1.320 Y RAB40AL n/a
9 TRCN0000048364 CCGCTGGTCTTTCGAGGGTAT pLKO.1 341 CDS 100% 1.350 0.675 Y RAB40AL n/a
10 TRCN0000154066 CATCATAGAGTCTTTCACGGA pLKO.1 533 CDS 100% 0.660 0.330 Y RAB40A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001031834.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05342 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05342 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474268 GGGGGATACACAACCCTTATTTTC pLX_317 17.3% 100% 100% V5 n/a
4 ccsbBroadEn_04961 pDONR223 100% 97.7% 97.8% None (many diffs) n/a
5 ccsbBroad304_04961 pLX_304 0% 97.7% 97.8% V5 (many diffs) n/a
6 TRCN0000466819 ATCAGCGCACGACGTAAACACCTG pLX_317 45.5% 97.7% 97.8% V5 (many diffs) n/a
7 ccsbBroadEn_07716 pDONR223 100% 90.2% 88.4% None (many diffs) n/a
8 ccsbBroad304_07716 pLX_304 0% 90.2% 88.4% V5 (many diffs) n/a
9 TRCN0000466345 CGCAGGAGGCATCCGCAAAATCTA pLX_317 7.8% 90.2% 88.4% V5 (many diffs) n/a
Download CSV