Transcript: Human XM_005256334.4

PREDICTED: Homo sapiens RAB40B, member RAS oncogene family (RAB40B), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAB40B (10966)
Length:
1962
CDS:
510..1166

Additional Resources:

NCBI RefSeq record:
XM_005256334.4
NBCI Gene record:
RAB40B (10966)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005256334.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047528 CGACTCTTGGTAACATGAAAT pLKO.1 1405 3UTR 100% 13.200 10.560 N RAB40B n/a
2 TRCN0000047529 CGGCATTGATCGATGGATTAA pLKO.1 638 CDS 100% 13.200 10.560 N RAB40B n/a
3 TRCN0000306768 CGGCATTGATCGATGGATTAA pLKO_005 638 CDS 100% 13.200 10.560 N RAB40B n/a
4 TRCN0000296259 ACTTCAGGCCAGGGAAGATTT pLKO_005 537 CDS 100% 13.200 9.240 N RAB40B n/a
5 TRCN0000380785 GCTGCAGATGTAGAGGTTATG pLKO_005 1630 3UTR 100% 10.800 7.560 N RAB40B n/a
6 TRCN0000380874 GCGAATGCTGCTTGCGAATGT pLKO_005 1264 3UTR 100% 4.950 3.465 N RAB40B n/a
7 TRCN0000047530 CCAGGATGATGCACGGCGGTT pLKO.1 1027 CDS 100% 0.000 0.000 N RAB40B n/a
8 TRCN0000289574 CCAGGATGATGCACGGCGGTT pLKO_005 1027 CDS 100% 0.000 0.000 N RAB40B n/a
9 TRCN0000296258 CTTAAGGAAGGCACTGAAAGA pLKO_005 1162 CDS 100% 4.950 2.970 N RAB40B n/a
10 TRCN0000047532 CCCTCTGTGCAATTTCAACAT pLKO.1 797 CDS 100% 4.950 2.475 Y RAB40B n/a
11 TRCN0000153551 CCCTCTGTGCAATTTCAACAT pLKO.1 797 CDS 100% 4.950 2.475 Y RAB40A n/a
12 TRCN0000048366 CGACTACAAGACGACCACCAT pLKO.1 253 5UTR 100% 2.640 1.320 Y RAB40AL n/a
13 TRCN0000048363 CTGTGCAATTTCAACATCATA pLKO.1 801 CDS 100% 5.625 2.813 Y RAB40AL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005256334.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07716 pDONR223 100% 77.6% 75% None (many diffs) n/a
2 ccsbBroad304_07716 pLX_304 0% 77.6% 75% V5 (many diffs) n/a
3 TRCN0000466345 CGCAGGAGGCATCCGCAAAATCTA pLX_317 7.8% 77.6% 75% V5 (many diffs) n/a
4 ccsbBroadEn_05342 pDONR223 100% 70.5% 68.2% None (many diffs) n/a
5 ccsbBroad304_05342 pLX_304 0% 70.5% 68.2% V5 (many diffs) n/a
6 TRCN0000474268 GGGGGATACACAACCCTTATTTTC pLX_317 17.3% 70.5% 68.2% V5 (many diffs) n/a
7 ccsbBroadEn_04961 pDONR223 100% 69.6% 67.1% None (many diffs) n/a
8 ccsbBroad304_04961 pLX_304 0% 69.6% 67.1% V5 (many diffs) n/a
9 TRCN0000466819 ATCAGCGCACGACGTAAACACCTG pLX_317 45.5% 69.6% 67.1% V5 (many diffs) n/a
Download CSV