Construct: ORF TRCN0000474302
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006426.1_s317c1
- Derived from:
- ccsbBroadEn_07445
- DNA Barcode:
- TAGCACATGCCGAATGAATTGTGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MACROH2A1 (9555)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474302
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9555 | MACROH2A1 | macroH2A.1 histone | NM_138610.2 | 99.9% | 99.7% | 1108G>C |
| 2 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XM_011543729.3 | 99.9% | 99.7% | 1108G>C |
| 3 | human | 9555 | MACROH2A1 | macroH2A.1 histone | NM_001040158.1 | 99.6% | 99.4% | 474_475insAAG;1105G>C |
| 4 | human | 9555 | MACROH2A1 | macroH2A.1 histone | NM_004893.3 | 99.6% | 99.4% | 474_475insAAG;1105G>C |
| 5 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XM_011543730.3 | 99.6% | 99.4% | 474_475insAAG;1105G>C |
| 6 | human | 9555 | MACROH2A1 | macroH2A.1 histone | NM_138609.2 | 94.2% | 93% | (many diffs) |
| 7 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XM_005272132.2 | 93.9% | 92.7% | (many diffs) |
| 8 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XM_011543731.2 | 72.5% | 68.8% | 776_777ins175;810_811ins131 |
| 9 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XM_011543732.2 | 72.3% | 68.6% | 474_475insAAG;773_774ins175;807_808ins131 |
| 10 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XM_024446263.1 | 66.9% | 62% | (many diffs) |
| 11 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XM_011543733.3 | 63.3% | 55.5% | (many diffs) |
| 12 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XM_017010067.2 | 63% | 55.3% | (many diffs) |
| 13 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XM_017010068.2 | 62.8% | 61% | (many diffs) |
| 14 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XM_024446264.1 | 59.6% | 53.1% | 474_475insAAG;583_584ins100;666_667ins347 |
| 15 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XR_948308.2 | 54.8% | (many diffs) | |
| 16 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XR_948307.2 | 54.7% | (many diffs) | |
| 17 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XR_948309.2 | 54.5% | (many diffs) | |
| 18 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XR_001742356.2 | 54.1% | (many diffs) | |
| 19 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XR_001742358.2 | 54% | (many diffs) | |
| 20 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XM_005272134.4 | 53.2% | 52.6% | (many diffs) |
| 21 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XR_948306.3 | 53.2% | (many diffs) | |
| 22 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XR_001742353.2 | 53% | (many diffs) | |
| 23 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XM_005272135.4 | 52.9% | 52.4% | (many diffs) |
| 24 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XM_011543734.3 | 52.6% | 52.6% | 588_589ins528 |
| 25 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XM_011543735.3 | 52.4% | 52.4% | 474_475insAAG;585_586ins528 |
| 26 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XR_948310.2 | 52.1% | (many diffs) | |
| 27 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XR_948311.2 | 51.9% | (many diffs) | |
| 28 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XR_001742359.2 | 51% | (many diffs) | |
| 29 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XR_001742354.2 | 50.4% | (many diffs) | |
| 30 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XR_001742355.2 | 50.3% | (many diffs) | |
| 31 | human | 9555 | MACROH2A1 | macroH2A.1 histone | XR_001742357.2 | 50.3% | (many diffs) | |
| 32 | mouse | 26914 | Macroh2a1 | macroH2A.1 histone | NM_012015.2 | 90.5% | 98.1% | (many diffs) |
| 33 | mouse | 26914 | Macroh2a1 | macroH2A.1 histone | NM_001159513.1 | 90.3% | 97.8% | (many diffs) |
| 34 | mouse | 26914 | Macroh2a1 | macroH2A.1 histone | NM_001159514.1 | 84.7% | 91.3% | (many diffs) |
| 35 | mouse | 26914 | Macroh2a1 | macroH2A.1 histone | NM_001159515.1 | 84.4% | 91.1% | (many diffs) |
| 36 | mouse | 26914 | Macroh2a1 | macroH2A.1 histone | XM_006517257.3 | 47.5% | 51.8% | (many diffs) |
| 37 | mouse | 26914 | Macroh2a1 | macroH2A.1 histone | XR_001780785.1 | 47.5% | (many diffs) | |
| 38 | mouse | 26914 | Macroh2a1 | macroH2A.1 histone | XR_382440.2 | 47.4% | (many diffs) | |
| 39 | mouse | 26914 | Macroh2a1 | macroH2A.1 histone | XR_001780786.1 | 47.4% | (many diffs) | |
| 40 | mouse | 26914 | Macroh2a1 | macroH2A.1 histone | XR_003950458.1 | 47.3% | (many diffs) | |
| 41 | mouse | 26914 | Macroh2a1 | macroH2A.1 histone | XM_006517258.3 | 47.3% | 51.6% | (many diffs) |
| 42 | mouse | 26914 | Macroh2a1 | macroH2A.1 histone | XR_001780784.1 | 46.4% | (many diffs) | |
| 43 | mouse | 26914 | Macroh2a1 | macroH2A.1 histone | XR_003950457.1 | 46.3% | (many diffs) | |
| 44 | mouse | 26914 | Macroh2a1 | macroH2A.1 histone | XR_003950456.1 | 28.5% | (many diffs) | |
| 45 | mouse | 26914 | Macroh2a1 | macroH2A.1 histone | XR_003950455.1 | 28.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1182
- ORF length:
- 1116
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc gagccgcggt gggaagaaga agtccaccaa gacgtccagg tctgccaaag 121 caggagtcat ctttcccgtg gggcggatgc tgcggtacat caagaaaggc caccccaagt 181 acaggattgg agtgggggca cccgtgtaca tggccgccgt cctggaatac ctgacagcgg 241 agattctgga gctggctggc aatgcagcga gagacaacaa gaagggacgg gtcacacccc 301 ggcacatcct gctggctgtg gccaatgatg aagagctgaa tcagctgcta aaaggagtca 361 ccatagccag tgggggtgtg ttacccaaca tccaccccga gttgctagcg aagaagcggg 421 gatccaaagg aaagttggaa gccatcatca caccaccccc agccaaaaag gccaagtctc 481 catcccagaa gaagcctgta tctaaaaaag caggaggcaa gaaaggggcc cggaaatcca 541 agaagaagca gggtgaagtc agtaaggcag ccagcgccga cagcacaacc gagggcacac 601 ctgccgacgg cttcacagtc ctctccacca agagcctctt ccttggccag aagctgaacc 661 ttattcacag tgaaatcagt aatttagccg gctttgaggt ggaggccata atcaatccta 721 ccaatgctga cattgacctt aaagatgacc taggaaacac gctggagaag aaaggtggca 781 aggagtttgt ggaagctgtc ctggaacTCC GGAAAAAGAA CGGGCCCTTG GAAGTAGCTG 841 GAGCTGCTGT CAGCGCAGGC CATGGCCTGC CTGCCAAGTT TGTGATCCAC TGTAATAGTC 901 CAGTTTGGGG TGCAGACAAG TGTGAAGAAC TTCTGGAAAA GACAGTGAAA AACTGCTTGG 961 CCCTGGCTGA TGATAAGAAG CTGAAATCCA TTGCATTTCC ATCCATCGGC AGCGGCAGGA 1021 ACGGTTTTCC AAAGCAGACA GCAGCTCAGC TGATTCTGAA GGCCATCTCC AGTTACTTCG 1081 TGTCTACAAT GTCCTCTTCC ATCAAAACGG TGTACTTCGT GCTTTTTGAC AGCGAGAGTA 1141 TAGGCATCTA TGTGCAGGAA ATGGCCAAGC TGCACGCCAA CTACCCAACT TTCTTGTACA 1201 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1261 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1321 AGGACGATAG CACATGCCGA ATGAATTGTG CACGCGTTAA GTCgacaatc aacctctgga 1381 ttacaaaatt tgtgaaagat t