Transcript: Human XR_001742357.2

PREDICTED: Homo sapiens macroH2A.1 histone (MACROH2A1), transcript variant X12, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MACROH2A1 (9555)
Length:
2082
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001742357.2
NBCI Gene record:
MACROH2A1 (9555)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001742357.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106693 CCAGTTACTTCGTGTCTACAA pLKO.1 1372 3UTR 100% 4.950 3.960 N MACROH2A1 n/a
2 TRCN0000311316 AGTTTGTGATCCACTGTAATA pLKO_005 1032 3UTR 100% 13.200 9.240 N Macroh2a1 n/a
3 TRCN0000413272 AGTTTGTGATCCACTGTAATA pLKO_005 1032 3UTR 100% 13.200 9.240 N MACROH2A1 n/a
4 TRCN0000418959 CAGAAGAAGCCTGTATCTAAA pLKO_005 654 3UTR 100% 13.200 9.240 N MACROH2A1 n/a
5 TRCN0000106690 GCGTGTGTTGTGGTGCTTTAT pLKO.1 1842 3UTR 100% 13.200 9.240 N MACROH2A1 n/a
6 TRCN0000348336 GTTTGTGATCCACTGTAATAG pLKO_005 1033 3UTR 100% 13.200 9.240 N Macroh2a1 n/a
7 TRCN0000418260 GAAAGTTGGAAGCCATCATCA pLKO_005 598 3UTR 100% 4.950 3.465 N MACROH2A1 n/a
8 TRCN0000422064 GAATACCTGACAGCGGAGATT pLKO_005 393 3UTR 100% 4.950 3.465 N MACROH2A1 n/a
9 TRCN0000106692 GCCAATGATGAAGAGCTGAAT pLKO.1 489 3UTR 100% 4.950 3.465 N MACROH2A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001742357.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07445 pDONR223 100% 50.3% None (many diffs) n/a
2 ccsbBroad304_07445 pLX_304 0% 50.3% V5 (many diffs) n/a
3 TRCN0000474302 TAGCACATGCCGAATGAATTGTGC pLX_317 33.8% 50.3% V5 (many diffs) n/a
Download CSV