Transcript: Mouse XR_003950458.1

PREDICTED: Mus musculus macroH2A.1 histone (Macroh2a1), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Macroh2a1 (26914)
Length:
2126
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_003950458.1
NBCI Gene record:
Macroh2a1 (26914)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_003950458.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106691 GCTGACATTGACCTTAAAGAT pLKO.1 972 3UTR 100% 5.625 7.875 N MACROH2A1 n/a
2 TRCN0000097039 GCCATAATCAATCCTACCAAT pLKO.1 951 3UTR 100% 4.950 6.930 N Macroh2a1 n/a
3 TRCN0000323465 GCCATAATCAATCCTACCAAT pLKO_005 951 3UTR 100% 4.950 6.930 N Macroh2a1 n/a
4 TRCN0000097040 GCCGAATATCCATCCTGAGTT pLKO.1 632 3UTR 100% 4.950 6.930 N Macroh2a1 n/a
5 TRCN0000351387 GCCGAATATCCATCCTGAGTT pLKO_005 632 3UTR 100% 4.950 6.930 N Macroh2a1 n/a
6 TRCN0000311316 AGTTTGTGATCCACTGTAATA pLKO_005 1214 3UTR 100% 13.200 9.240 N Macroh2a1 n/a
7 TRCN0000413272 AGTTTGTGATCCACTGTAATA pLKO_005 1214 3UTR 100% 13.200 9.240 N MACROH2A1 n/a
8 TRCN0000311318 GGTAGCTGGAGCTGCTATTAG pLKO_005 1170 3UTR 100% 13.200 9.240 N Macroh2a1 n/a
9 TRCN0000348336 GTTTGTGATCCACTGTAATAG pLKO_005 1215 3UTR 100% 13.200 9.240 N Macroh2a1 n/a
10 TRCN0000106694 CTGAACCTTATTCACAGTGAA pLKO.1 900 3UTR 100% 4.950 3.465 N MACROH2A1 n/a
11 TRCN0000097041 CATCAAGAAAGGCCACCCTAA pLKO.1 407 3UTR 100% 4.050 2.835 N Macroh2a1 n/a
12 TRCN0000097043 CAGCTACTTTGTCTCCACGAT pLKO.1 1407 3UTR 100% 2.640 1.848 N Macroh2a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_003950458.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07445 pDONR223 100% 47.3% None (many diffs) n/a
2 ccsbBroad304_07445 pLX_304 0% 47.3% V5 (many diffs) n/a
3 TRCN0000474302 TAGCACATGCCGAATGAATTGTGC pLX_317 33.8% 47.3% V5 (many diffs) n/a
Download CSV