Construct: ORF TRCN0000474382
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008863.1_s317c1
- Derived from:
- ccsbBroadEn_06139
- DNA Barcode:
- GTACGTTCCACACTCCACCCCTAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PHC2 (1912)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474382
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1912 | PHC2 | polyhomeotic homolog 2 | NM_004427.4 | 99.5% | 99.3% | (many diffs) |
| 2 | human | 1912 | PHC2 | polyhomeotic homolog 2 | NM_001330488.1 | 38.7% | 38.6% | (many diffs) |
| 3 | human | 1912 | PHC2 | polyhomeotic homolog 2 | NM_198040.2 | 37.4% | 37.4% | (many diffs) |
| 4 | mouse | 54383 | Phc2 | polyhomeotic-like 2 (Drosop... | NM_001195083.1 | 91.9% | 96.5% | (many diffs) |
| 5 | mouse | 54383 | Phc2 | polyhomeotic-like 2 (Drosop... | XM_006503237.3 | 91.9% | 96.5% | (many diffs) |
| 6 | mouse | 54383 | Phc2 | polyhomeotic-like 2 (Drosop... | XM_006503238.1 | 91.9% | 96.5% | (many diffs) |
| 7 | mouse | 54383 | Phc2 | polyhomeotic-like 2 (Drosop... | XM_006503236.1 | 81.3% | 85.4% | (many diffs) |
| 8 | mouse | 54383 | Phc2 | polyhomeotic-like 2 (Drosop... | XM_006503234.1 | 36.1% | 38% | (many diffs) |
| 9 | mouse | 54383 | Phc2 | polyhomeotic-like 2 (Drosop... | NM_001195130.1 | 34.9% | 36.7% | (many diffs) |
| 10 | mouse | 54383 | Phc2 | polyhomeotic-like 2 (Drosop... | NM_018774.4 | 34.9% | 36.7% | (many diffs) |
| 11 | mouse | 54383 | Phc2 | polyhomeotic-like 2 (Drosop... | XM_017320320.1 | 34.9% | 36.7% | (many diffs) |
| 12 | mouse | 54383 | Phc2 | polyhomeotic-like 2 (Drosop... | XR_376334.3 | 20% | (many diffs) | |
| 13 | mouse | 54383 | Phc2 | polyhomeotic-like 2 (Drosop... | XM_006503235.1 | 18.9% | 15.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1035
- ORF length:
- 969
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac ctcagagaac ggaaactctg cctccagcat cgccggcact gccccccaga 121 atggtgagaa taaaccacca caggccattg tgaaacccca aatcctgacg catgttatcg 181 aagggtttgt gatccaggag ggggcggagc ctttcccggt gggacgctcg tccctgctgg 241 tggggaatct caagaagaag tatgcacagg ggttcctgcc tgagaaactt ccacagcagg 301 atcacaccac caccactgac tcggagatgg aggagcccta tctgcaagaa tccaaagagg 361 agggtgcccc cctcaaactc aagtgtgagc tctgtggccg ggtggacttt gcctataagt 421 tcaagcgttc caagcgcttc tgttccatgg cttgtgcaaa gaggtacaac gtgggatgca 481 ccaaacgggt gggacttttc cactcagacc ggagcaagct gcagaaggca ggagctgcga 541 cccacaaccg ccgtcgggCC AGCAAAGCCA GTCTGCCACC ACTTACCAAG GATACCAAGA 601 AGCAGCCAAC AGGCACTGTG CCCCTTTCGG TTACTGCTGC TTTGCAGCTA ACACACAGCC 661 AGGAAGACTC CAGCCGTTGC TCAGATAACT CAAGCTATGA GGAACCCTTG TCACCCATCT 721 CAGCCAGCTC ATCTACTTCC CGCCGGCGAC AAGGCCAGCG GGACCTGGAG CTCCCCGACA 781 TGCATATGCG GGACCTGGTG GGCATGGGAC ACCACTTCCT GCCAAGTGAG CCCACCAAGT 841 GGAATGTAGA AGACGTCTAC GAATTCATCC GCTCTCTGCC AGGCTGCCAG GAGATAGAAG 901 AGGAATTCCG TGCCCAGGAA ATCGACGGGC AAGCCCTGCT GCTGCTCAAG GAGGACCACC 961 TGATGAGCGC CATGAACATC AAGCTGGGGC CCGCCCTGAA GATCTATGCC CGCATCAGCA 1021 TGCTCAAGGA CTCCTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1081 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1141 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA GTACGTTCCA CACTCCACCC 1201 CTACACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt