Transcript: Mouse NM_001195130.1

Mus musculus polyhomeotic-like 2 (Drosophila) (Phc2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Phc2 (54383)
Length:
3949
CDS:
170..2722

Additional Resources:

NCBI RefSeq record:
NM_001195130.1
NBCI Gene record:
Phc2 (54383)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001195130.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164889 GACGCATGTTATCGAAGGGTT pLKO.1 1852 CDS 100% 2.640 3.696 N PHC2 n/a
2 TRCN0000108969 CCAAATCCTGACGCATGTTAT pLKO.1 1843 CDS 100% 13.200 10.560 N Phc2 n/a
3 TRCN0000108966 GCTTGTGCAAAGAGGTATAAT pLKO.1 2135 CDS 100% 15.000 10.500 N Phc2 n/a
4 TRCN0000108967 CCCTACCTGCAAGAATCCAAA pLKO.1 2021 CDS 100% 4.950 3.465 N Phc2 n/a
5 TRCN0000166773 CCTCAAACTCAAGTGTGAGCT pLKO.1 2056 CDS 100% 2.640 1.848 N PHC2 n/a
6 TRCN0000292519 CCTCAAACTCAAGTGTGAGCT pLKO_005 2056 CDS 100% 2.640 1.848 N PHC2 n/a
7 TRCN0000108965 CCTCCAGATAGCAAGAGGTTT pLKO.1 3487 3UTR 100% 4.950 2.970 N Phc2 n/a
8 TRCN0000166083 GCTTCCTCCAAAGTCCCAATA pLKO.1 2991 3UTR 100% 10.800 7.560 N PHC2 n/a
9 TRCN0000292443 GCTTCCTCCAAAGTCCCAATA pLKO_005 2991 3UTR 100% 10.800 7.560 N PHC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001195130.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15402 pDONR223 0% 35% 36.9% None (many diffs) n/a
2 ccsbBroad304_15402 pLX_304 0% 35% 36.9% V5 (many diffs) n/a
3 TRCN0000473871 CTTAGCAAAAATCTCAGTATCTTA pLX_317 49.8% 35% 36.9% V5 (many diffs) n/a
4 ccsbBroadEn_06139 pDONR223 100% 34.9% 36.7% None (many diffs) n/a
5 ccsbBroad304_06139 pLX_304 0% 34.9% 36.7% V5 (many diffs) n/a
6 TRCN0000474382 GTACGTTCCACACTCCACCCCTAC pLX_317 49.2% 34.9% 36.7% V5 (many diffs) n/a
Download CSV