Transcript: Human NM_001330488.1

Homo sapiens polyhomeotic homolog 2 (PHC2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
PHC2 (1912)
Length:
3789
CDS:
55..2547

Additional Resources:

NCBI RefSeq record:
NM_001330488.1
NBCI Gene record:
PHC2 (1912)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330488.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164741 CAAAGAGGTACAACGTGGGAT pLKO.1 1967 CDS 100% 2.640 3.696 N PHC2 n/a
2 TRCN0000166773 CCTCAAACTCAAGTGTGAGCT pLKO.1 1881 CDS 100% 2.640 3.696 N PHC2 n/a
3 TRCN0000292519 CCTCAAACTCAAGTGTGAGCT pLKO_005 1881 CDS 100% 2.640 3.696 N PHC2 n/a
4 TRCN0000164889 GACGCATGTTATCGAAGGGTT pLKO.1 1677 CDS 100% 2.640 3.696 N PHC2 n/a
5 TRCN0000108969 CCAAATCCTGACGCATGTTAT pLKO.1 1668 CDS 100% 13.200 10.560 N Phc2 n/a
6 TRCN0000166774 CTCAAGCTATGAGGAACCCTT pLKO.1 2199 CDS 100% 2.640 2.112 N PHC2 n/a
7 TRCN0000292520 CTCAAGCTATGAGGAACCCTT pLKO_005 2199 CDS 100% 2.640 2.112 N PHC2 n/a
8 TRCN0000162731 CCCACACTTCTTTGCCTATAA pLKO.1 3557 3UTR 100% 13.200 9.240 N PHC2 n/a
9 TRCN0000292442 CCCACACTTCTTTGCCTATAA pLKO_005 3557 3UTR 100% 13.200 9.240 N PHC2 n/a
10 TRCN0000166083 GCTTCCTCCAAAGTCCCAATA pLKO.1 2795 3UTR 100% 10.800 7.560 N PHC2 n/a
11 TRCN0000292443 GCTTCCTCCAAAGTCCCAATA pLKO_005 2795 3UTR 100% 10.800 7.560 N PHC2 n/a
12 TRCN0000166824 CCCACCAAGTGGAATGTAGAA pLKO.1 2341 CDS 100% 4.950 3.465 N PHC2 n/a
13 TRCN0000166216 CCTTTCGGTTACTGCTGCTTT pLKO.1 2133 CDS 100% 4.950 3.465 N PHC2 n/a
14 TRCN0000166084 GCCGTTGCTCAGATAACTCAA pLKO.1 2183 CDS 100% 4.950 3.465 N PHC2 n/a
15 TRCN0000292446 GCCGTTGCTCAGATAACTCAA pLKO_005 2183 CDS 100% 4.950 3.465 N PHC2 n/a
16 TRCN0000165233 GCCCTATCTGCAAGAATCCAA pLKO.1 1845 CDS 100% 3.000 2.100 N PHC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330488.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15402 pDONR223 0% 38.9% 38.9% None 1_1521del n/a
2 ccsbBroad304_15402 pLX_304 0% 38.9% 38.9% V5 1_1521del n/a
3 TRCN0000473871 CTTAGCAAAAATCTCAGTATCTTA pLX_317 49.8% 38.9% 38.9% V5 1_1521del n/a
4 ccsbBroadEn_06139 pDONR223 100% 38.7% 38.6% None (many diffs) n/a
5 ccsbBroad304_06139 pLX_304 0% 38.7% 38.6% V5 (many diffs) n/a
6 TRCN0000474382 GTACGTTCCACACTCCACCCCTAC pLX_317 49.2% 38.7% 38.6% V5 (many diffs) n/a
Download CSV