Construct: ORF TRCN0000474403
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002375.1_s317c1
- Derived from:
- ccsbBroadEn_03749
- DNA Barcode:
- CCAAGTCGCCTCGGGGTTTTTTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AGPAT3 (56894)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474403
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 56894 | AGPAT3 | 1-acylglycerol-3-phosphate ... | NM_001037553.2 | 100% | 100% | |
| 2 | human | 56894 | AGPAT3 | 1-acylglycerol-3-phosphate ... | NM_001369878.1 | 100% | 100% | |
| 3 | human | 56894 | AGPAT3 | 1-acylglycerol-3-phosphate ... | NM_001369880.1 | 100% | 100% | |
| 4 | human | 56894 | AGPAT3 | 1-acylglycerol-3-phosphate ... | NM_020132.5 | 100% | 100% | |
| 5 | human | 56894 | AGPAT3 | 1-acylglycerol-3-phosphate ... | XM_005261160.4 | 100% | 100% | |
| 6 | human | 56894 | AGPAT3 | 1-acylglycerol-3-phosphate ... | XM_006724029.3 | 100% | 100% | |
| 7 | human | 56894 | AGPAT3 | 1-acylglycerol-3-phosphate ... | XM_006724030.3 | 100% | 100% | |
| 8 | human | 56894 | AGPAT3 | 1-acylglycerol-3-phosphate ... | XM_011529665.2 | 100% | 100% | |
| 9 | human | 56894 | AGPAT3 | 1-acylglycerol-3-phosphate ... | XM_011529660.2 | 85.6% | 81.1% | 1_58del;124_125ins112 |
| 10 | human | 56894 | AGPAT3 | 1-acylglycerol-3-phosphate ... | NM_001369881.1 | 83.5% | 83.5% | 0_1ins186 |
| 11 | human | 56894 | AGPAT3 | 1-acylglycerol-3-phosphate ... | XM_006724031.3 | 83.5% | 83.5% | 0_1ins186 |
| 12 | human | 56894 | AGPAT3 | 1-acylglycerol-3-phosphate ... | XM_017028411.1 | 83.5% | 83.5% | 0_1ins186 |
| 13 | human | 56894 | AGPAT3 | 1-acylglycerol-3-phosphate ... | XM_017028412.1 | 83.5% | 83.5% | 0_1ins186 |
| 14 | human | 56894 | AGPAT3 | 1-acylglycerol-3-phosphate ... | XM_011529662.2 | 81.2% | 81.2% | 1_261del |
| 15 | human | 56894 | AGPAT3 | 1-acylglycerol-3-phosphate ... | XM_011529664.2 | 81.1% | 76.9% | 1_124del;190_191ins112 |
| 16 | human | 56894 | AGPAT3 | 1-acylglycerol-3-phosphate ... | XM_017028408.1 | 76.3% | 76.4% | 1_202del;268_269ins112 |
| 17 | human | 56894 | AGPAT3 | 1-acylglycerol-3-phosphate ... | XM_011529663.2 | 74.7% | 70.8% | 1_232del;298_299ins112 |
| 18 | human | 56894 | AGPAT3 | 1-acylglycerol-3-phosphate ... | XM_011529661.2 | 69.4% | 65.9% | 1_334del;400_401ins112 |
| 19 | mouse | 28169 | Agpat3 | 1-acylglycerol-3-phosphate ... | NM_053014.3 | 86.2% | 92.2% | (many diffs) |
| 20 | mouse | 28169 | Agpat3 | 1-acylglycerol-3-phosphate ... | XM_006513716.2 | 86.2% | 92.2% | (many diffs) |
| 21 | mouse | 28169 | Agpat3 | 1-acylglycerol-3-phosphate ... | XM_006513717.3 | 86.2% | 92.2% | (many diffs) |
| 22 | mouse | 28169 | Agpat3 | 1-acylglycerol-3-phosphate ... | XM_006513718.1 | 86.2% | 92.2% | (many diffs) |
| 23 | mouse | 28169 | Agpat3 | 1-acylglycerol-3-phosphate ... | XM_006513719.2 | 86.2% | 92.2% | (many diffs) |
| 24 | mouse | 28169 | Agpat3 | 1-acylglycerol-3-phosphate ... | XM_006513720.1 | 86.2% | 92.2% | (many diffs) |
| 25 | mouse | 28169 | Agpat3 | 1-acylglycerol-3-phosphate ... | XM_006513721.1 | 86.2% | 92.2% | (many diffs) |
| 26 | mouse | 28169 | Agpat3 | 1-acylglycerol-3-phosphate ... | XM_006513722.3 | 86.2% | 92.2% | (many diffs) |
| 27 | mouse | 28169 | Agpat3 | 1-acylglycerol-3-phosphate ... | XM_006513723.3 | 86.2% | 92.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1194
- ORF length:
- 1128
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg cctgctggcc ttcctgaaga cccagttcgt gctgcacctg ctggtcggct 121 ttgtcttcgt ggtgagtggt ctggtcatca acttcgtcca gctgtgcacg ctggcgctct 181 ggccggtcag caagcagctc taccgccgcc tcaactgccg cctcgcctac tcactctgga 241 gccaactggt catgctgctg gagtggtggt cctgcacgga gtgtacactg ttcacggacc 301 aggccacggt agagcgcttt gggaaggagc acgcagtcat catcctcaac cacaacttcg 361 agatcgactt cctctgtggg tggaccatgt gtgagcgctt cggagtgctg gggagctcca 421 aggtcctcgc taagaaggag ctgctctacg tgcccctcat cggctggacg tggtactttc 481 tggagattgt gttctgcaag cggaagtggg aggaggaccg ggacaccgtg gtcgaagggc 541 tgaggcgcct gtcggactac cccgagtaca tgtggtttct cctgtactgc gaggggacgc 601 gcttcacgga gaccaagcac cgcgttagca tggaggtggc ggctgctaag gggcttcctg 661 tcctcaagta ccacctgctg ccgcggacca agggcttcac caccgcagtc aagtgcctcc 721 gggggacagt cgcagctgtc tatgatgtaa ccctgaactt cagaggaaac aagaacccgt 781 ccctgctggg gatcctctac gggaagaagt acgaggcgga catgtgcgtg aggagatttc 841 ctctggaaga catCCCGCTG GATGAAAAGG AAGCAGCTCA GTGGCTTCAT AAACTGTACC 901 AGGAGAAGGA CGCGCTCCAG GAGATATATA ATCAGAAGGG CATGTTTCCA GGGGAGCAGT 961 TTAAGCCTGC CCGGAGGCCG TGGACCCTCC TGAACTTCCT GTCCTGGGCC ACCATTCTCC 1021 TGTCTCCCCT CTTCAGTTTT GTCTTGGGCG TCTTTGCCAG CGGATCACCT CTCCTGATCC 1081 TGACTTTCTT GGGGTTTGTG GGAGCAGCTT CCTTTGGAGT TCGCAGACTG ATAGGAGTAA 1141 CTGAGATAGA AAAAGGCTCC AGCTACGGAA ACCAAGAGTT TAAGAAAAAG GAATACCCAA 1201 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1261 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1321 TATCTTGTGG AAAGGACGAC CAAGTCGCCT CGGGGTTTTT TTCACGCGTT AAGTCgacaa 1381 tcaacctctg gattacaaaa tttgtgaaag att