Transcript: Human XM_017028411.1

PREDICTED: Homo sapiens 1-acylglycerol-3-phosphate O-acyltransferase 3 (AGPAT3), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AGPAT3 (56894)
Length:
5940
CDS:
248..1192

Additional Resources:

NCBI RefSeq record:
XM_017028411.1
NBCI Gene record:
AGPAT3 (56894)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028411.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419813 GACATGTGCGTGAGGAGATTT pLKO_005 815 CDS 100% 13.200 18.480 N AGPAT3 n/a
2 TRCN0000035138 GATTGTGTTCTGCAAGCGGAA pLKO.1 481 CDS 100% 2.160 3.024 N AGPAT3 n/a
3 TRCN0000035137 GCGCTCCAGGAGATATATAAT pLKO.1 908 CDS 100% 15.000 12.000 N AGPAT3 n/a
4 TRCN0000427286 TCGCAGACTGATAGGAGTAAC pLKO_005 1117 CDS 100% 10.800 8.640 N AGPAT3 n/a
5 TRCN0000035134 GCTACGGAAACCAAGAGTTTA pLKO.1 1158 CDS 100% 13.200 9.240 N AGPAT3 n/a
6 TRCN0000432513 CAGTTATCTTGGGAACTTAAC pLKO_005 1537 3UTR 100% 10.800 7.560 N AGPAT3 n/a
7 TRCN0000035136 CCTGAACTTCAGAGGAAACAA pLKO.1 748 CDS 100% 5.625 3.938 N AGPAT3 n/a
8 TRCN0000035135 CCTCAACCACAACTTCGAGAT pLKO.1 340 CDS 100% 4.050 2.835 N AGPAT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028411.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03749 pDONR223 100% 83.5% 83.5% None 0_1ins186 n/a
2 ccsbBroad304_03749 pLX_304 0% 83.5% 83.5% V5 0_1ins186 n/a
3 TRCN0000474403 CCAAGTCGCCTCGGGGTTTTTTTC pLX_317 30.5% 83.5% 83.5% V5 0_1ins186 n/a
4 ccsbBroadEn_08654 pDONR223 100% 83.4% 83.5% None 0_1ins186;198C>T n/a
5 ccsbBroad304_08654 pLX_304 0% 83.4% 83.5% V5 0_1ins186;198C>T n/a
6 TRCN0000467671 GGAGATGCTCACATGTAGACGTCT pLX_317 36.1% 83.4% 83.5% V5 0_1ins186;198C>T n/a
Download CSV