Construct: ORF TRCN0000474409
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008013.1_s317c1
- Derived from:
- ccsbBroadEn_01035
- DNA Barcode:
- ATGTTCTAGTGGACGGCGATTTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MSH5 (4439)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474409
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4439 | MSH5 | mutS homolog 5 | NM_172165.3 | 100% | 100% | |
| 2 | human | 4439 | MSH5 | mutS homolog 5 | NM_002441.4 | 99.8% | 99.8% | 1959_1960insCAG |
| 3 | human | 4439 | MSH5 | mutS homolog 5 | NM_172166.4 | 99.8% | 99.8% | 1959_1960insCAG |
| 4 | human | 4439 | MSH5 | mutS homolog 5 | NM_025259.5 | 94.4% | 94.4% | 538_588del;2281_2282ins90 |
| 5 | human | 100532732 | MSH5-SAPCD1 | MSH5-SAPCD1 readthrough (NM... | NR_037846.1 | 61.4% | (many diffs) | |
| 6 | mouse | 17687 | Msh5 | mutS homolog 5 | NM_001146215.2 | 86.4% | 88.4% | (many diffs) |
| 7 | mouse | 17687 | Msh5 | mutS homolog 5 | NM_013600.3 | 86.4% | 88.4% | (many diffs) |
| 8 | mouse | 17687 | Msh5 | mutS homolog 5 | XM_011246314.1 | 86.3% | 88.3% | (many diffs) |
| 9 | mouse | 17687 | Msh5 | mutS homolog 5 | XM_006523771.3 | 85.1% | 86.3% | (many diffs) |
| 10 | mouse | 17687 | Msh5 | mutS homolog 5 | XM_006523770.1 | 84.6% | 85.6% | (many diffs) |
| 11 | mouse | 17687 | Msh5 | mutS homolog 5 | XM_006523778.1 | 81.3% | 83.1% | (many diffs) |
| 12 | mouse | 17687 | Msh5 | mutS homolog 5 | XM_017317278.1 | 78% | 80.2% | (many diffs) |
| 13 | mouse | 17687 | Msh5 | mutS homolog 5 | XM_017317279.1 | 77.9% | 80% | (many diffs) |
| 14 | mouse | 17687 | Msh5 | mutS homolog 5 | XM_017317280.1 | 76.7% | 78.8% | (many diffs) |
| 15 | mouse | 17687 | Msh5 | mutS homolog 5 | XM_017317281.1 | 75.8% | 78.1% | (many diffs) |
| 16 | mouse | 17687 | Msh5 | mutS homolog 5 | XM_017317282.1 | 75.7% | 77.7% | (many diffs) |
| 17 | mouse | 17687 | Msh5 | mutS homolog 5 | NR_130640.1 | 74.5% | (many diffs) | |
| 18 | mouse | 17687 | Msh5 | mutS homolog 5 | XM_017317283.1 | 74.1% | 75.4% | (many diffs) |
| 19 | mouse | 17687 | Msh5 | mutS homolog 5 | XM_017317284.1 | 72.9% | 74.3% | (many diffs) |
| 20 | mouse | 17687 | Msh5 | mutS homolog 5 | XM_017317285.1 | 72% | 73.7% | (many diffs) |
| 21 | mouse | 17687 | Msh5 | mutS homolog 5 | NR_130641.1 | 71.9% | (many diffs) | |
| 22 | mouse | 17687 | Msh5 | mutS homolog 5 | XM_006523780.3 | 70.8% | 73.6% | (many diffs) |
| 23 | mouse | 17687 | Msh5 | mutS homolog 5 | XR_001782050.1 | 66% | (many diffs) | |
| 24 | mouse | 17687 | Msh5 | mutS homolog 5 | XR_001782053.1 | 64.6% | (many diffs) | |
| 25 | mouse | 17687 | Msh5 | mutS homolog 5 | XR_001782049.1 | 62.5% | (many diffs) | |
| 26 | mouse | 17687 | Msh5 | mutS homolog 5 | XR_001782051.1 | 57.3% | (many diffs) | |
| 27 | mouse | 17687 | Msh5 | mutS homolog 5 | XR_001782054.1 | 56.1% | (many diffs) | |
| 28 | mouse | 17687 | Msh5 | mutS homolog 5 | XM_017317286.1 | 55.7% | 56.9% | (many diffs) |
| 29 | mouse | 17687 | Msh5 | mutS homolog 5 | XR_001782052.1 | 52.1% | (many diffs) | |
| 30 | mouse | 17687 | Msh5 | mutS homolog 5 | XM_017317288.1 | 37.5% | 36.1% | (many diffs) |
| 31 | mouse | 17687 | Msh5 | mutS homolog 5 | XM_017317289.1 | 37.5% | 36.1% | (many diffs) |
| 32 | mouse | 17687 | Msh5 | mutS homolog 5 | XM_017317290.1 | 37.5% | 36.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2571
- ORF length:
- 2505
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ctccttagga gcgaacccaa ggaggacacc gcagggaccg agacctgggg 121 cggcctcctc cggcttcccc agcccggccc cagtgccggg ccccagggag gccgaggagg 181 aggaagtcga ggaggaggag gagctggccg agatccatct gtgtgtgctg tggaattcag 241 gatacttggg cattgcctac tatgatacta gtgactccac tatccacttc atgccagatg 301 ccccagacca cgagagcctc aagcttctcc agagagttct ggatgagatc aatccccagt 361 ctgttgttac gagtgccaaa caggatgaga atatgactcg atttctggga aagcttgcct 421 cccaggagca cagagagcct aaaagacctg aaatcatatt tttgccaagt gtggattttg 481 gtctggagat aagcaaacaa cgcctccttt ctggaaacta ctccttcatc ccagacgcca 541 tgactgccac tgagaaaatc ctcttcctct cttccattat tccctttgac tgcctcctca 601 cagttcgagc acttggaggg ctgctgaagt tcctgggtcg aagaagaatc ggggttgaac 661 tggaagacta taatgtcagc gtccccatcc tgggctttaa gaaatttatg ttgactcatc 721 tggtgaacat agatcaagac acttacagtg ttctacagat ttttaagagt gagtctcacc 781 cctcagtgta caaagtggcc agtggactga aggaggggct cagcctcttt ggaatcctca 841 acagatgcca ctgtaagtgg ggagagaagc tgctcaggct atggttcaca cgtccgactc 901 atgacctggg ggagctcagt tctcgtctgg acgtcattca gttttttctg ctgccccaga 961 atctggacat ggctcagatg ctgcatcggc tcctgggtca catcaagaac gtgcctctga 1021 ttctgaaacg catgaagttg tcccacacca aggtcagcga ctggcaggtt ctctacaaga 1081 ctgtgtacag tgccctgggc ctgagggatg cctgccgctc cctgccgcag tccatccagc 1141 tctttcggga cattgcccaa gagttctctg atgacctgca ccatatcgcc agcctcattg 1201 ggaaagtagt ggactttgag ggcagccttg ctgaaaatcg cttcacagtc ctccccaaca 1261 tagatcctga aattgatgag aaaaagcgaa gactgatggg acttcccagt ttccttactg 1321 aggttgcccg caaggagctg gagaatctgg actcccgtat tccttcatgc agtgtcatct 1381 acatccctct gattggcttc cttctttcta ttccccgcct gccttccatg gtagaggcca 1441 gtgactttga gattaatgga ctggacttca tgtttctctc agaggagaag ctgcactatc 1501 gtagtgcccg aaccaaggag ctggatgcat tgctggggga cctgcactgc gagatccggg 1561 accaggagac gctgctgatg taccagctac agtgccaggt gctggcacga gcagctgtct 1621 taacccgagt attggacctt gcctcccgcc tggacgtcct gctggctctt gccagtgctg 1681 cccgggacta tggctactca aggccgcgtt actccccaca agtccttggg gtacgaatcc 1741 agaatggcag acatcctctg atggaactct gtgcccgaac ctttgtgccc aactccacag 1801 aatgtggtgg ggacaaaggg agggtcaaag tcatcactgg acccaactca tcagggaaga 1861 gcatatacct caaacaggta ggcttgatca cattcatggc cctggtaggc agctttgtgc 1921 cagcagagga ggccgaaatt ggggcagtag acgccatctt cacacgaatt catagctgcg 1981 aatccatctc ccttggcctc tccaccttca tgatcgacct caaccagcag gtggcgaaag 2041 cagtgaacaa tgccactgca cagtcgctgg tccttattga tgaatttgga aagggaacca 2101 acacggtgga tgggctcgcg cttctggccg ctgtgctccg acactggctg gcacgtggac 2161 ccacatgccc ccacatcttt gtggccacca actttctgag ccttgtTCAG CTACAACTGC 2221 TGCCACAAGG GCCCCTGGTG CAGTATTTGA CCATGGAGAC CTGTGAGGAT GGCAACGATC 2281 TTGTCTTCTT CTATCAGGTT TGCGAAGGTG TTGCGAAGGC CAGCCATGCC TCCCACACAG 2341 CTGCCCAGGC TGGGCTTCCT GACAAGCTTG TGGCTCGTGG CAAGGAGGTC TCAGACTTGA 2401 TCCGCAGTGG AAAACCCATC AAGCCTGTCA AGGATTTGCT AAAGAAGAAC CAAATGGAAA 2461 ATTGCCAGAC ATTAGTGGAT AAGTTTATGA AACTGGATTT GGAAGATCCT AACCTGGACT 2521 TGAACGTTTT CATGAGCCAG GAAGTGCTGC CTGCTGCCAC CAGCATCCTC TGCCCAACTT 2581 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 2641 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 2701 CTTGTGGAAA GGACGAATGT TCTAGTGGAC GGCGATTTCG ACGCGTTAAG TCgacaatca 2761 acctctggat tacaaaattt gtgaaagatt