Transcript: Mouse XR_001782052.1

PREDICTED: Mus musculus mutS homolog 5 (Msh5), transcript variant X18, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Msh5 (17687)
Length:
2330
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782052.1
NBCI Gene record:
Msh5 (17687)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782052.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192063 CAAGACACTTACAGCGTTCTA pLKO.1 1004 3UTR 100% 4.950 6.930 N Msh5 n/a
2 TRCN0000201096 CCTAACATAGACCCTGACATA pLKO.1 1523 3UTR 100% 4.950 3.465 N Msh5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782052.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01036 pDONR223 100% 52.9% None (many diffs) n/a
2 ccsbBroad304_01036 pLX_304 0% 52.9% V5 (many diffs) n/a
3 ccsbBroadEn_01035 pDONR223 100% 52.1% None (many diffs) n/a
4 ccsbBroad304_01035 pLX_304 0% 52.1% V5 (many diffs) n/a
5 TRCN0000474409 ATGTTCTAGTGGACGGCGATTTCG pLX_317 14.8% 52.1% V5 (many diffs) n/a
Download CSV