Transcript: Human NM_025259.5

Homo sapiens mutS homolog 5 (MSH5), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
MSH5 (4439)
Length:
2751
CDS:
129..2597

Additional Resources:

NCBI RefSeq record:
NM_025259.5
NBCI Gene record:
MSH5 (4439)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025259.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235071 GTTGAACTGGAAGACTATAAT pLKO_005 768 CDS 100% 15.000 7.500 Y MSH5 n/a
2 TRCN0000235074 AGACATTAGTGGATAAGTTTA pLKO_005 2491 CDS 100% 13.200 6.600 Y MSH5 n/a
3 TRCN0000235072 AGCTGTCTTAACCCGAGTATT pLKO_005 1727 CDS 100% 13.200 6.600 Y MSH5 n/a
4 TRCN0000039954 CCCAACATAGATCCTGAAATT pLKO.1 1368 CDS 100% 13.200 6.600 Y MSH5 n/a
5 TRCN0000238809 GCACAGTCGCTGGTCCTTATT pLKO_005 2172 CDS 100% 13.200 6.600 Y MSH5 n/a
6 TRCN0000235073 TCATCAGGGAAGAGCATATAC pLKO_005 1962 CDS 100% 13.200 6.600 Y MSH5 n/a
7 TRCN0000039955 CCAGACATTAGTGGATAAGTT pLKO.1 2489 CDS 100% 5.625 2.813 Y MSH5 n/a
8 TRCN0000039956 CCTCTCTTCCATTATTCCCTT pLKO.1 629 CDS 100% 2.640 1.320 Y MSH5 n/a
9 TRCN0000039957 GACGCCATCTTCACACGAATT pLKO.1 2064 CDS 100% 0.000 0.000 Y MSH5 n/a
10 TRCN0000010386 GATACTAGTGACTCCACTATC pLKO.1 327 CDS 100% 0.000 0.000 Y MSH5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025259.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01036 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01036 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_01035 pDONR223 100% 94.4% 94.4% None 538_588del;2281_2282ins90 n/a
4 ccsbBroad304_01035 pLX_304 0% 94.4% 94.4% V5 538_588del;2281_2282ins90 n/a
5 TRCN0000474409 ATGTTCTAGTGGACGGCGATTTCG pLX_317 14.8% 94.4% 94.4% V5 538_588del;2281_2282ins90 n/a
Download CSV