Construct: ORF TRCN0000474411
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011626.1_s317c1
- Derived from:
- ccsbBroadEn_10798
- DNA Barcode:
- GAGTGCCAGCATAGCCTTATCTGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- EGR2 (1959)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474411
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1959 | EGR2 | early growth response 2 | NM_000399.5 | 95.3% | 95.3% | 734_735ins69 |
| 2 | human | 1959 | EGR2 | early growth response 2 | NM_001136177.3 | 95.3% | 95.3% | 734_735ins69 |
| 3 | human | 1959 | EGR2 | early growth response 2 | NM_001136178.1 | 95.3% | 95.3% | 734_735ins69 |
| 4 | human | 1959 | EGR2 | early growth response 2 | XM_011539427.1 | 91% | 90% | (many diffs) |
| 5 | human | 1959 | EGR2 | early growth response 2 | NM_001136179.3 | 85.3% | 85.3% | 0_1ins150;584_585ins69 |
| 6 | human | 1959 | EGR2 | early growth response 2 | NM_001321037.2 | 85.3% | 85.3% | 0_1ins150;584_585ins69 |
| 7 | mouse | 13654 | Egr2 | early growth response 2 | NM_010118.3 | 82% | 84.5% | (many diffs) |
| 8 | mouse | 13654 | Egr2 | early growth response 2 | XM_011243367.2 | 78.3% | 79.6% | (many diffs) |
| 9 | mouse | 13654 | Egr2 | early growth response 2 | NM_001347458.1 | 72.7% | 75.7% | (many diffs) |
| 10 | mouse | 13654 | Egr2 | early growth response 2 | XM_006513209.2 | 72.7% | 75.7% | (many diffs) |
| 11 | mouse | 13654 | Egr2 | early growth response 2 | XM_006513210.2 | 72.7% | 75.7% | (many diffs) |
| 12 | mouse | 13654 | Egr2 | early growth response 2 | XM_006513211.2 | 72.7% | 75.7% | (many diffs) |
| 13 | mouse | 13654 | Egr2 | early growth response 2 | XM_006513213.3 | 72.7% | 75.7% | (many diffs) |
| 14 | mouse | 13654 | Egr2 | early growth response 2 | XM_011243368.2 | 72.7% | 75.7% | (many diffs) |
| 15 | mouse | 13654 | Egr2 | early growth response 2 | XM_006513208.3 | 65.5% | 66.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1563
- ORF length:
- 1497
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat gaccgccaag gccgtagaca aaatcccagt aactctcagt ggttttgtgc 121 accagctgtc tgacaacatc tacccggtgg aggacctcgc cgccacgtcg gtgaccatct 181 ttcccaatgc cgaactggga ggcccctttg accagatgaa cggagtggcc ggagatggca 241 tgatcaacat tgacatgact ggagagaaga ggtcgttgga tctcccatat cccagcagct 301 ttgctcccgt ctctgcacct agaaaccaga ccttcactta catgggcaag ttctccattg 361 accctcagta ccctggtgcc agctgctacc cagaaggcat aatcaatatt gtgagtgcag 421 gcatcttgca aggggtcact tccccagctt caaccacagc ctcatccagc gtcacctctg 481 cctcccccaa cccactggcc acaggacccc tgggtgtgtg caccatgtcc cagacccagc 541 ctgacctgga ccacctgtac tctccgccac cgcctcctcc tccttattct ggctgtgcag 601 gagacctcta ccaggaccct tctgcgttcc tgtcagcagc caccacctcc acctcttcct 661 ctctggccta cccaccacct ccttcctatc catcccccaa gccagccacg gacccaggtc 721 tcttcccaat gatcccagac tatcctggat tctttccatc tcagtgccag agagacctac 781 atggtacagc tggcccagac cgtaagccct ttccctgccc actggacacc ctgcgggtgc 841 cccctccact cactccactc tctacaatcc gtaagccctt tccctgccca ctggacaccc 901 tgcgggtgcc ccctccactc actccactct ctacaatccg taactttacc ctggggggcc 961 ccagtgctgg ggtgaccgga ccaggggcca gtggaggcag cgagggaccc cggctgcctg 1021 gtagcagctc agcagcagca gcagccgccg ccgccgccgc ctataaccca caccacctgc 1081 cactgcggcc cattctgagg cctcgcaagt accccaacag acccagcaag acgccggtgc 1141 acgagaggcc ctacccgtgc ccagcagaag gctgcgaccg gcggttctcc cgctctgacg 1201 agctgacacg gcacatccga atccacactg ggcataagcc cttccagtgt cggatctgca 1261 tgcgcaactt cagccgcagt gaccacctca ccacccatat ccgcacccac accggtgaga 1321 agcccttcgc ctgtgactac tgtggccgaa agtttgcccg gagtgatgag aggaagcgcc 1381 acaccaagat ccacctgaga cagaaagagc ggaaaagcag tgccccctcT GCATCGGTGC 1441 CAGCCCCCTC TACAGCCTCC TGCTCTGGGG GCGTGCAGCC TGGGGGTACC CTGTGCAGCA 1501 GTAACAGCAG CAGTCTTGGC GGAGGGCCGC TCGCCCCTTG CTCCTCTCGG ACCCGGACAC 1561 CTTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1621 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1681 GGCTTTATAT ATCTTGTGGA AAGGACGAGA GTGCCAGCAT AGCCTTATCT GCACGCGTTA 1741 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt