Transcript: Human XM_011539427.1

PREDICTED: Homo sapiens early growth response 2 (EGR2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EGR2 (1959)
Length:
2696
CDS:
16..1485

Additional Resources:

NCBI RefSeq record:
XM_011539427.1
NBCI Gene record:
EGR2 (1959)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539427.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013840 CTCTCTACAATCCGTAACTTT pLKO.1 847 CDS 100% 5.625 7.875 N EGR2 n/a
2 TRCN0000235778 CTGTATATTTCTGCCTATTAA pLKO_005 2437 3UTR 100% 15.000 10.500 N Egr2 n/a
3 TRCN0000081678 GCTGTATATTTCTGCCTATTA pLKO.1 2436 3UTR 100% 13.200 9.240 N Egr2 n/a
4 TRCN0000235775 GAGATGGCATGATCAACATTG pLKO_005 221 CDS 100% 10.800 7.560 N Egr2 n/a
5 TRCN0000013839 CCCAGACTATCCTGGATTCTT pLKO.1 723 CDS 100% 5.625 3.938 N EGR2 n/a
6 TRCN0000013841 CTTCACTTACATGGGCAAGTT pLKO.1 321 CDS 100% 4.950 3.465 N EGR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539427.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10798 pDONR223 100% 91% 90% None (many diffs) n/a
2 ccsbBroad304_10798 pLX_304 0% 91% 90% V5 (many diffs) n/a
3 TRCN0000474411 GAGTGCCAGCATAGCCTTATCTGC pLX_317 9.4% 91% 90% V5 (many diffs) n/a
Download CSV