Transcript: Mouse NM_001347458.1

Mus musculus early growth response 2 (Egr2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Egr2 (13654)
Length:
2630
CDS:
141..1403

Additional Resources:

NCBI RefSeq record:
NM_001347458.1
NBCI Gene record:
Egr2 (13654)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347458.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081678 GCTGTATATTTCTGCCTATTA pLKO.1 2336 3UTR 100% 13.200 18.480 N Egr2 n/a
2 TRCN0000081679 CCACTCTCTACCATCCGTAAT pLKO.1 780 CDS 100% 10.800 15.120 N Egr2 n/a
3 TRCN0000235777 ACTATTGTGGCCGCAAGTTTG pLKO_005 1183 CDS 100% 10.800 8.640 N Egr2 n/a
4 TRCN0000235776 ACTCTCTACCATCCGTAATTT pLKO_005 782 CDS 100% 15.000 10.500 N Egr2 n/a
5 TRCN0000081680 CCAGAAGGTATCATCAATATT pLKO.1 315 CDS 100% 15.000 10.500 N Egr2 n/a
6 TRCN0000235778 CTGTATATTTCTGCCTATTAA pLKO_005 2337 3UTR 100% 15.000 10.500 N Egr2 n/a
7 TRCN0000218224 AGGATCCTTCAGCATTCTTAT pLKO_005 538 CDS 100% 13.200 9.240 N Egr2 n/a
8 TRCN0000235775 GAGATGGCATGATCAACATTG pLKO_005 157 CDS 100% 10.800 7.560 N Egr2 n/a
9 TRCN0000081682 CCAGGATCCTTCAGCATTCTT pLKO.1 536 CDS 100% 5.625 3.938 N Egr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347458.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10798 pDONR223 100% 72.7% 75.7% None (many diffs) n/a
2 ccsbBroad304_10798 pLX_304 0% 72.7% 75.7% V5 (many diffs) n/a
3 TRCN0000474411 GAGTGCCAGCATAGCCTTATCTGC pLX_317 9.4% 72.7% 75.7% V5 (many diffs) n/a
Download CSV