Construct: ORF TRCN0000474439
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013063.1_s317c1
- Derived from:
- ccsbBroadEn_14408
- DNA Barcode:
- ACGGGGGATAACCCAGTCATCAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RUNDC3B (154661)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474439
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 154661 | RUNDC3B | RUN domain containing 3B | NM_001134406.2 | 94.6% | 92.6% | (many diffs) |
| 2 | human | 154661 | RUNDC3B | RUN domain containing 3B | XM_011515827.1 | 90.8% | 88.9% | (many diffs) |
| 3 | human | 154661 | RUNDC3B | RUN domain containing 3B | XM_005250156.2 | 84.8% | 83% | (many diffs) |
| 4 | human | 154661 | RUNDC3B | RUN domain containing 3B | NM_001134405.2 | 84.5% | 82.6% | (many diffs) |
| 5 | human | 154661 | RUNDC3B | RUN domain containing 3B | XM_011515826.1 | 81.8% | 80% | (many diffs) |
| 6 | human | 154661 | RUNDC3B | RUN domain containing 3B | NM_138290.3 | 81.4% | 79.7% | (many diffs) |
| 7 | human | 154661 | RUNDC3B | RUN domain containing 3B | XM_017011765.2 | 66.7% | 64.8% | (many diffs) |
| 8 | human | 154661 | RUNDC3B | RUN domain containing 3B | XM_017011766.2 | 66.7% | 64.8% | (many diffs) |
| 9 | human | 154661 | RUNDC3B | RUN domain containing 3B | XM_024446669.1 | 65.1% | 62.4% | (many diffs) |
| 10 | human | 154661 | RUNDC3B | RUN domain containing 3B | XM_011515828.2 | 59.5% | 57.8% | (many diffs) |
| 11 | human | 154661 | RUNDC3B | RUN domain containing 3B | XM_011515829.2 | 59.5% | 57.8% | (many diffs) |
| 12 | human | 154661 | RUNDC3B | RUN domain containing 3B | XM_017011761.2 | 59.5% | 57.8% | (many diffs) |
| 13 | human | 154661 | RUNDC3B | RUN domain containing 3B | XM_017011762.1 | 59.5% | 57.8% | (many diffs) |
| 14 | human | 154661 | RUNDC3B | RUN domain containing 3B | XM_017011763.2 | 59.5% | 57.8% | (many diffs) |
| 15 | human | 154661 | RUNDC3B | RUN domain containing 3B | XM_017011764.1 | 58.3% | 55.9% | (many diffs) |
| 16 | human | 154661 | RUNDC3B | RUN domain containing 3B | XM_005250158.2 | 58.1% | 55.7% | (many diffs) |
| 17 | mouse | 242819 | Rundc3b | RUN domain containing 3B | NM_198620.1 | 84.7% | 87.7% | (many diffs) |
| 18 | mouse | 242819 | Rundc3b | RUN domain containing 3B | XM_006503578.2 | 76% | 78.6% | (many diffs) |
| 19 | mouse | 242819 | Rundc3b | RUN domain containing 3B | NM_001347311.1 | 75.7% | 78.3% | (many diffs) |
| 20 | mouse | 242819 | Rundc3b | RUN domain containing 3B | XM_006503579.3 | 74% | 78.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1227
- ORF length:
- 1161
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ctcccggagc ctggggggcc tgagcgggat ccgcggcggt ggcggcggag 121 gcggcaagaa aagcctgagc gcccgcaatg ctgcggtgga gaggaggaac ctgatcaccg 181 tgtgcaggtt ttctgtgaag accatgattg atcggtcttg ctttgagaca attgatgatt 241 cttctcctga atttaacaat tttgcagcta ttttggaaca gattttaagc caccggctaa 301 aaggtcaagt aacctggttt ggttatgaaa gtcctcgtag cttctgggac tatatcagag 361 tggcttgccg gaaagtttca cagaattgta tctgcagcat tgaaaatatg gaaaatgtca 421 gttcttctag agctaagggt agagcctgga tcagagtagc actcatggaa aaacatttat 481 ctgaatacat ctctacagct ctgagagact tcaaaacaac caggagattt tatgaagatg 541 gagcaattgt cttgggtgaa gaagcaaata tgcttgctgg catgcttcta ggactcaatg 601 ctattgattt cagtttctgc ctaaagggag gggggctgga tggcagtttt cctgctgtaa 661 tagactatac accatatttg aagtatatcc aaagttctga tagtatcagt agtgatgagg 721 aggagctaag gactttggga agcagtggta gcgaaagcag tactccagag aatgtcggac 781 ctcctttcct catggatgag aacagttggt tcaacaagtg taagagagtt aaacaaaagt 841 aTCAGCTTAC CCTGGAACAG AAGGGTTACC TTGAAGAACT CTTACGACTT CGAGAGAACC 901 AACTATCTGA ATCTGTCTCC CAGAATAAAA TACTACTTCA AAGGATTGAA GATTCCGATC 961 TGGCTCATAA ACTGGAGAAG GAACAATTAG AATATATAAT TGTGGAGCTT CAAGATCAGC 1021 TGAAAAGTTA TCAAAGTCTT GACCAGTTAT CAGCAGAAGT TAGCCTTTCT CAGACTTCAC 1081 TAGATCCAGG CCAGTCACAA GAAGGAGATG GAAAACAAGA CACATTAAAT GTAATGAGTG 1141 AAGGTAAGGA AGATACTCCC TCATTACTTG GCCTCTGTGG ATCTCCAACG TCAGTCAAGT 1201 TAAAAGTCTC TAACAAGCTT AAAATCTACC CAACTTTCTT GTACAAAGTG GTTGATATCG 1261 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1321 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAACGGGGGA 1381 TAACCCAGTC ATCAGTACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1441 aagatt