Transcript: Mouse NM_198620.1

Mus musculus RUN domain containing 3B (Rundc3b), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Rundc3b (242819)
Length:
3700
CDS:
341..1567

Additional Resources:

NCBI RefSeq record:
NM_198620.1
NBCI Gene record:
Rundc3b (242819)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198620.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106085 CGCTCCTTTATTTGGTGGTTA pLKO.1 1943 3UTR 100% 4.950 6.930 N Rundc3b n/a
2 TRCN0000106086 GCCCACAAATTGGAGAAAGAA pLKO.1 1241 CDS 100% 5.625 4.500 N Rundc3b n/a
3 TRCN0000106087 GCAAGACTCATTGAATTTCAT pLKO.1 1393 CDS 100% 5.625 3.938 N Rundc3b n/a
4 TRCN0000106088 GCTGTTCTGGAACAAATTCTA pLKO.1 545 CDS 100% 5.625 3.938 N Rundc3b n/a
5 TRCN0000106089 TGAACAAAGTTCTGACAGCAT pLKO.1 964 CDS 100% 2.640 1.848 N Rundc3b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198620.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14408 pDONR223 100% 84.7% 87.7% None (many diffs) n/a
2 ccsbBroad304_14408 pLX_304 0% 84.7% 87.7% V5 (many diffs) n/a
3 TRCN0000474439 ACGGGGGATAACCCAGTCATCAGT pLX_317 33.5% 84.7% 87.7% V5 (many diffs) n/a
Download CSV