Construct: ORF TRCN0000474483
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015385.1_s317c1
- Derived from:
- ccsbBroadEn_05527
- DNA Barcode:
- ATTTTCTCTGTCTTCTGGTAATAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GPR141 (353345)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474483
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 353345 | GPR141 | G protein-coupled receptor 141 | NM_001329993.2 | 100% | 100% | |
2 | human | 353345 | GPR141 | G protein-coupled receptor 141 | NM_001329994.2 | 100% | 100% | |
3 | human | 353345 | GPR141 | G protein-coupled receptor 141 | NM_181791.3 | 100% | 100% | |
4 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_011515385.2 | 100% | 100% | |
5 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_011515386.2 | 100% | 100% | |
6 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_011515388.2 | 100% | 100% | |
7 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_011515389.2 | 100% | 100% | |
8 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_017012165.1 | 100% | 100% | |
9 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_017012166.1 | 100% | 100% | |
10 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_011515383.3 | 97.4% | 97.4% | 1_24del |
11 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_017012164.1 | 97.4% | 97.4% | 1_24del |
12 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_017012163.2 | 90.7% | 90.7% | 1_93del |
13 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_017012161.2 | 84.2% | 84.2% | 1_171del |
14 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_011515375.3 | 74.7% | 74.7% | 1_309del |
15 | human | 353345 | GPR141 | G protein-coupled receptor 141 | XM_011515374.3 | 72.6% | 72.6% | 1_345del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 984
- ORF length:
- 915
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcctggccac aatacctcca ggaattcctc ttgcgatcct atagtgacac 121 cccacttaat cagcctctac ttcatagtgc ttattggcgg gctggtgggt gtcatttcca 181 ttcttttcct cctggtgaaa atgaacaccc ggtcagtgac caccatggcg gtcattaact 241 tggtggtggt ccacagcgtt tttctgctga cagtgccatt tcgcttgacc tacctcatca 301 agaagacttg gatgtttggg ctgcccttct gcaaatttgt gagtgccatg ctgcacatcc 361 acatgtacct cacgttccta ttctatgtgg tgatcctggt caccagatac ctcatcttct 421 tcaagtgcaa agacaaagtg gaattctaca gaaaactgca tgctgtggct gccagtgctg 481 gcatgtggac gctggtgatt gtcattgtgg taccccTGGT TGTCTCCCGG TATGGAATCC 541 ATGAGGAATA CAATGAGGAG CACTGTTTTA AATTTCACAA AGAGCTTGCT TACACATATG 601 TGAAAATCAT CAACTATATG ATAGTCATTT TTGTCATAGC CGTTGCTGTG ATTCTGTTGG 661 TCTTCCAGGT CTTCATCATT ATGTTGATGG TGCAGAAGCT ACGCCACTCT TTACTATCCC 721 ACCAGGAGTT CTGGGCTCAG CTGAAAAACC TATTTTTTAT AGGGGTCATC CTTGTTTGTT 781 TCCTTCCCTA CCAGTTCTTT AGGATCTATT ACTTGAATGT TGTGACGCAT TCCAATGCCT 841 GTAACAGCAA GGTTGCATTT TATAACGAAA TCTTCTTGAG TGTAACAGCA ATTAGCTGCT 901 ATGATTTGCT TCTCTTTGTC TTTGGGGGAA GCCATTGGTT TAAGCAAAAG ATAATTGGCT 961 TATGGAATTG TGTTTTGTGC CGTTTGCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1021 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGCCCGTAAC 1081 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA TTTTCTCTGT 1141 CTTCTGGTAA TAAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1201 att