Transcript: Human XM_011515374.3

PREDICTED: Homo sapiens G protein-coupled receptor 141 (GPR141), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPR141 (353345)
Length:
4203
CDS:
417..1679

Additional Resources:

NCBI RefSeq record:
XM_011515374.3
NBCI Gene record:
GPR141 (353345)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515374.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358422 GACCACCATGGCGGTCATTAA pLKO_005 911 CDS 100% 13.200 18.480 N GPR141 n/a
2 TRCN0000358420 CTCTACTTCATAGTGCTTATT pLKO_005 828 CDS 100% 13.200 10.560 N GPR141 n/a
3 TRCN0000358338 ACCAGTTCTTTAGGATCTATT pLKO_005 1483 CDS 100% 13.200 9.240 N GPR141 n/a
4 TRCN0000014445 CCAGTTCTTTAGGATCTATTA pLKO.1 1484 CDS 100% 13.200 9.240 N GPR141 n/a
5 TRCN0000014447 CCTCTACTTCATAGTGCTTAT pLKO.1 827 CDS 100% 10.800 7.560 N GPR141 n/a
6 TRCN0000014443 CCAGGTCTTCATCATTATGTT pLKO.1 1358 CDS 100% 5.625 3.938 N GPR141 n/a
7 TRCN0000014446 GTTCCTATTCTATGTGGTGAT pLKO.1 1067 CDS 100% 4.050 2.835 N GPR141 n/a
8 TRCN0000014444 CCACTTAATCAGCCTCTACTT pLKO.1 815 CDS 100% 4.950 2.970 N GPR141 n/a
9 TRCN0000149064 GCAGGTTTGTTACATAGGTAT pLKO.1 2667 3UTR 100% 4.950 2.475 Y GLIPR1L2 n/a
10 TRCN0000009295 GCAGGTTTGTTACATAGGTAA pLKO.1 2667 3UTR 100% 4.950 2.475 Y OR11A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515374.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05527 pDONR223 100% 72.6% 72.6% None 1_345del n/a
2 ccsbBroad304_05527 pLX_304 0% 72.6% 72.6% V5 1_345del n/a
3 TRCN0000474483 ATTTTCTCTGTCTTCTGGTAATAA pLX_317 50.9% 72.6% 72.6% V5 1_345del n/a
4 TRCN0000488276 CACTTCATGTCTTTCTTATAAGGT pLX_317 34.7% 72.6% 72.6% V5 (not translated due to prior stop codon) 1_345del n/a
5 TRCN0000489788 GCAGACGTCATGCTTGGCAGCCAG pLX_317 41.3% 72.5% 72.4% V5 1_345del;1260_1261insG n/a
Download CSV