Transcript: Human XM_017012166.1

PREDICTED: Homo sapiens G protein-coupled receptor 141 (GPR141), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPR141 (353345)
Length:
4932
CDS:
1491..2408

Additional Resources:

NCBI RefSeq record:
XM_017012166.1
NBCI Gene record:
GPR141 (353345)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012166.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358422 GACCACCATGGCGGTCATTAA pLKO_005 1640 CDS 100% 13.200 18.480 N GPR141 n/a
2 TRCN0000358420 CTCTACTTCATAGTGCTTATT pLKO_005 1557 CDS 100% 13.200 10.560 N GPR141 n/a
3 TRCN0000358338 ACCAGTTCTTTAGGATCTATT pLKO_005 2212 CDS 100% 13.200 9.240 N GPR141 n/a
4 TRCN0000014445 CCAGTTCTTTAGGATCTATTA pLKO.1 2213 CDS 100% 13.200 9.240 N GPR141 n/a
5 TRCN0000014447 CCTCTACTTCATAGTGCTTAT pLKO.1 1556 CDS 100% 10.800 7.560 N GPR141 n/a
6 TRCN0000014443 CCAGGTCTTCATCATTATGTT pLKO.1 2087 CDS 100% 5.625 3.938 N GPR141 n/a
7 TRCN0000014446 GTTCCTATTCTATGTGGTGAT pLKO.1 1796 CDS 100% 4.050 2.835 N GPR141 n/a
8 TRCN0000014444 CCACTTAATCAGCCTCTACTT pLKO.1 1544 CDS 100% 4.950 2.970 N GPR141 n/a
9 TRCN0000149064 GCAGGTTTGTTACATAGGTAT pLKO.1 3396 3UTR 100% 4.950 2.475 Y GLIPR1L2 n/a
10 TRCN0000009295 GCAGGTTTGTTACATAGGTAA pLKO.1 3396 3UTR 100% 4.950 2.475 Y OR11A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012166.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05527 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05527 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474483 ATTTTCTCTGTCTTCTGGTAATAA pLX_317 50.9% 100% 100% V5 n/a
4 TRCN0000488276 CACTTCATGTCTTTCTTATAAGGT pLX_317 34.7% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000489788 GCAGACGTCATGCTTGGCAGCCAG pLX_317 41.3% 99.8% 99.6% V5 915_916insG n/a
Download CSV