Construct: ORF TRCN0000474587
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003506.1_s317c1
- Derived from:
- ccsbBroadEn_11003
- DNA Barcode:
- GGTGGATACCTAGTGTGAAACCCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NRF1 (4899)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474587
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4899 | NRF1 | nuclear respiratory factor 1 | NM_001293163.2 | 100% | 100% | |
| 2 | human | 4899 | NRF1 | nuclear respiratory factor 1 | NM_001040110.1 | 96.3% | 96.3% | 1347_1348ins57 |
| 3 | human | 4899 | NRF1 | nuclear respiratory factor 1 | NM_005011.5 | 96.3% | 96.3% | 1347_1348ins57 |
| 4 | human | 4899 | NRF1 | nuclear respiratory factor 1 | NM_001293164.2 | 65.5% | 65.5% | 0_1ins483;864_865ins57 |
| 5 | mouse | 18181 | Nrf1 | nuclear respiratory factor 1 | NM_001164226.1 | 88.8% | 96.1% | (many diffs) |
| 6 | mouse | 18181 | Nrf1 | nuclear respiratory factor 1 | NM_010938.4 | 88.8% | 96.1% | (many diffs) |
| 7 | mouse | 18181 | Nrf1 | nuclear respiratory factor 1 | XM_017321444.1 | 88.8% | 96.1% | (many diffs) |
| 8 | mouse | 18181 | Nrf1 | nuclear respiratory factor 1 | XM_017321445.1 | 88.8% | 96.1% | (many diffs) |
| 9 | mouse | 18181 | Nrf1 | nuclear respiratory factor 1 | XM_011241048.1 | 86.8% | 94% | (many diffs) |
| 10 | mouse | 18181 | Nrf1 | nuclear respiratory factor 1 | XM_017321443.1 | 86.8% | 94% | (many diffs) |
| 11 | mouse | 18181 | Nrf1 | nuclear respiratory factor 1 | NM_001164230.1 | 82.1% | 85.2% | (many diffs) |
| 12 | mouse | 18181 | Nrf1 | nuclear respiratory factor 1 | NM_001164227.1 | 82% | 82.1% | (many diffs) |
| 13 | mouse | 18181 | Nrf1 | nuclear respiratory factor 1 | XM_006505006.3 | 82% | 82.1% | (many diffs) |
| 14 | mouse | 18181 | Nrf1 | nuclear respiratory factor 1 | XM_017321441.1 | 82% | 82.1% | (many diffs) |
| 15 | mouse | 18181 | Nrf1 | nuclear respiratory factor 1 | XM_017321442.1 | 82% | 82.1% | (many diffs) |
| 16 | mouse | 18181 | Nrf1 | nuclear respiratory factor 1 | XM_006505008.2 | 80.8% | 86.5% | (many diffs) |
| 17 | mouse | 18181 | Nrf1 | nuclear respiratory factor 1 | NM_001164229.1 | 80.3% | 83.3% | (many diffs) |
| 18 | mouse | 18181 | Nrf1 | nuclear respiratory factor 1 | XM_006505005.3 | 80.2% | 80.4% | (many diffs) |
| 19 | mouse | 18181 | Nrf1 | nuclear respiratory factor 1 | XM_011241044.1 | 80.2% | 80.4% | (many diffs) |
| 20 | mouse | 18181 | Nrf1 | nuclear respiratory factor 1 | XM_011241046.2 | 80.2% | 80.4% | (many diffs) |
| 21 | mouse | 18181 | Nrf1 | nuclear respiratory factor 1 | XM_017321440.1 | 80.2% | 80.4% | (many diffs) |
| 22 | mouse | 18181 | Nrf1 | nuclear respiratory factor 1 | NM_001164228.1 | 76.3% | 76.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1632
- ORF length:
- 1566
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggaacacgga gtgacccaaa ccgaacatat ggctaccata gaagcacatg 121 cagtggccca gcaagtgcag caggtccatg tggctactta caccgagcat agtatgctga 181 gtgctgatga agactcgcct tcttctcccg aggacacctc ttacgatgac tcagatatac 241 tcaactccac agcagctgat gaggtgacag ctcatctggc agctgcaggt cctgtgggaa 301 tggccgctgc tgctgctgtg gcaacaggaa agaaacggaa acggcctcat gtatttgagt 361 ctaatccatc tatccggaag aggcaacaaa cacgtttgct tcggaaactt cgagccacgt 421 tagatgaata tactactcgt gtgggacagc aagctattgt cctctgtatc tcaccctcca 481 aacctaaccc tgtctttaaa gtgtttggtg cagcaccttt ggagaatgtg gtgcgtaagt 541 acaagagcat gatcctggaa gacctggagt ctgctctggc agaacacgcc cctgcgccac 601 aggaggttaa ctcagaactg ccgcctctca ccatcgacgg aattccagtc tctgtggaca 661 aaatgaccca ggcccagctt cgggcattta tcccagagat gctcaagtac tctacaggtc 721 ggggaaaacc aggctggggg aaagaaagct gcaagcccat ctggtggcct gaagatatcc 781 cctgggcaaa tgtccggagt gatgtccgca cagaagagca aaagcagagg gtttcatgga 841 cccaggcact acggaccata gttaaaaact gttataaaca gcatgggcgg gaagaccttt 901 tgtatgcctt tgaagatcag caaacgcaaa cacaggccac agccacacat agtatagctc 961 atcttgtacc atcacagact gtagtccaga cttttagtaa ccctgatggc actgtctcac 1021 ttatccaggt tggtacgggg gcaacagtag ccacattggc tgatgcttca gaattgccaa 1081 ccacggtcac cgttgcccaa gtgaattaTT CTGCCGTGGC TGATGGAGAG GTGGAACAAA 1141 ATTGGGCCAC GTTACAGGGA GGTGAGATGA CCATCCAGAC GACGCAAGCA TCAGAGGCCA 1201 CCCAGGCGGT GGCATCGTTG GCAGAGGCCG CAGTGGCAGC TTCTCAGGAG ATGCAGCAGG 1261 GAGCTACAGT CACTATGGCG CTTAACAGCG AAGCTGCCGC CCATGCTGTC GCCACCCTGG 1321 CTGAGGCCAC CTTACAAGGT GGGGGACAGA TCGTCTTGTC TGGGGAAACC GCAGCAGCCG 1381 TCGGAGCACT TACTGGAGTC CAAGATGCTA ATGGCCTCTT TATGGCAGAT CGTGCAGGTC 1441 GCAAGTGGAT CCTGACTGAC AAAGCCACAG GCCTGGTCCA GATCCCTGTG AGCATGTACC 1501 AGACTGTGGT GACCAGCCTC GCCCAGGGCA ACGGACCAGT GCAGGTGGCC ATGGCCCCTG 1561 TGACCACCAG GATATCAGAC AGCGCAGTCA CCATGGACGG CCAAGCTGTG GAGGTGGTGA 1621 CATTGGAACA GTGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1681 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1741 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAGGT GGATACCTAG TGTGAAACCC 1801 GACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t