Transcript: Mouse XM_017321444.1

PREDICTED: Mus musculus nuclear respiratory factor 1 (Nrf1), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nrf1 (18181)
Length:
4733
CDS:
1716..3227

Additional Resources:

NCBI RefSeq record:
XM_017321444.1
NBCI Gene record:
Nrf1 (18181)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235828 CACGTTACAGGGCGGTGAAAT pLKO_005 2798 CDS 100% 13.200 18.480 N Nrf1 n/a
2 TRCN0000235827 TCCCGTGCGTGATAGTGTATT pLKO_005 4586 3UTR 100% 13.200 18.480 N Nrf1 n/a
3 TRCN0000085095 CCCGAGGACACTTCTTATGAT pLKO.1 1857 CDS 100% 5.625 7.875 N Nrf1 n/a
4 TRCN0000085096 GCGATTGTACTCTGCATCTCA pLKO.1 2103 CDS 100% 3.000 4.200 N Nrf1 n/a
5 TRCN0000235825 CTGCGCCACAGGAGGTTAATT pLKO_005 2242 CDS 100% 15.000 12.000 N Nrf1 n/a
6 TRCN0000085094 CCTCATGTGTTTGAGTCTAAT pLKO.1 1995 CDS 100% 13.200 9.240 N Nrf1 n/a
7 TRCN0000235826 TCCCAGAGATGCTCAAGTATT pLKO_005 2341 CDS 100% 13.200 9.240 N Nrf1 n/a
8 TRCN0000085093 CCAGACTTCTTTGTGCAGAAA pLKO.1 3462 3UTR 100% 4.950 3.465 N Nrf1 n/a
9 TRCN0000085097 GCAAGCGATTGTACTCTGCAT pLKO.1 2099 CDS 100% 2.640 1.848 N Nrf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11003 pDONR223 100% 88.8% 96.1% None (many diffs) n/a
2 ccsbBroad304_11003 pLX_304 0% 88.8% 96.1% V5 (many diffs) n/a
3 TRCN0000474587 GGTGGATACCTAGTGTGAAACCCG pLX_317 33.6% 88.8% 96.1% V5 (many diffs) n/a
Download CSV