Transcript: Human NM_001293163.2

Homo sapiens nuclear respiratory factor 1 (NRF1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
NRF1 (4899)
Length:
3578
CDS:
115..1683

Additional Resources:

NCBI RefSeq record:
NM_001293163.2
NBCI Gene record:
NRF1 (4899)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001293163.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415781 TATCCGGAAGAGGCAACAAAC pLKO_005 420 CDS 100% 10.800 15.120 N NRF1 n/a
2 TRCN0000016905 CCACGTTAGATGAATATACTA pLKO.1 464 CDS 100% 5.625 7.875 N NRF1 n/a
3 TRCN0000016906 GCGTAAGTACAAGAGCATGAT pLKO.1 582 CDS 100% 4.950 6.930 N NRF1 n/a
4 TRCN0000016907 CAAGATGCTAATGGCCTCTTT pLKO.1 1450 CDS 100% 4.950 6.435 N NRF1 n/a
5 TRCN0000016903 CCTCATGTATTTGAGTCTAAT pLKO.1 394 CDS 100% 13.200 10.560 N NRF1 n/a
6 TRCN0000016904 CCGTTGCCCAAGTGAATTATT pLKO.1 1139 CDS 100% 15.000 10.500 N NRF1 n/a
7 TRCN0000433393 CTTACGATGACTCAGATATAC pLKO_005 269 CDS 100% 13.200 9.240 N NRF1 n/a
8 TRCN0000235825 CTGCGCCACAGGAGGTTAATT pLKO_005 641 CDS 100% 15.000 21.000 N Nrf1 n/a
9 TRCN0000235826 TCCCAGAGATGCTCAAGTATT pLKO_005 740 CDS 100% 13.200 9.240 N Nrf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001293163.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11003 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_11003 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474587 GGTGGATACCTAGTGTGAAACCCG pLX_317 33.6% 100% 100% V5 n/a
Download CSV